Strain Name:
C57BL/6J-MtgxR8862Btlr/Mmmh
Stock Number:
068741-MU
Citation ID:
RRID:MMRRC_068741-MU
Other Names:
R8862 (G1)
Major Collection:

Strain Information

Alg10b
Name: ALG10 alpha-1,2-glucosyltransferase
Synonyms: LOC380959, Deaf1, nse5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380959
VEGA: 15
Homologene: 6030
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Gnai2
Name: G protein subunit alpha i2
Synonyms: Gnai-2, Galphai2, Gia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14678
HGNC: HGNC:4385
Homologene: 55539
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 9630045K08Rik, 4733401D09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Lgals9
Name: lectin, galactose binding, soluble 9
Synonyms: galectin-9, Lgals5, gal-9, LGALS35
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16859
Homologene: 134662
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: Dopey1, B130005I07Rik, D9Ertd809e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Ankfy1
Name: ankyrin repeat and FYVE domain containing 1
Synonyms: Ankhzn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11736
Homologene: 9491
Rsf1
Name: remodeling and spacing factor 1
Synonyms: 4832420A03Rik, p325, C030033M12Rik, Hbxap, XAP8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Gas2l3
Name: growth arrest-specific 2 like 3
Synonyms: LOC237436, 8430435B07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237436
VEGA: 10
Homologene: 18386
Acin1
Name: apoptotic chromatin condensation inducer 1
Synonyms: 2610036I19Rik, Acinus, 2610510L13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56215
Homologene: 22853
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Tomm70a
Name: translocase of outer mitochondrial membrane 70A
Synonyms: 2610044B22Rik, Tom70, D16Ium22, Tomm70a, D16Wsu109e, D16Ium22e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 28185
VEGA: 16
Homologene: 40112
Syngr2
Name: synaptogyrin 2
Synonyms: cellugyrin, Clast2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20973
Homologene: 20987
Sox8
Name: SRY (sex determining region Y)-box 8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20681
Homologene: 7950
Tardbp
Name: TAR DNA binding protein
Synonyms: Tdp43, 1190002A23Rik, TDP-43
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230908
Homologene: 7221
Ror1
Name: receptor tyrosine kinase-like orphan receptor 1
Synonyms: 2810404D04Rik, Ntrkr1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26563
Homologene: 3675
Prune2
Name: prune homolog 2
Synonyms: Olfaxin, A330102H22Rik, A230083H22Rik, 6330414G02Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Acf1, Wcrf180
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Kctd10
Name: potassium channel tetramerisation domain containing 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330171
Homologene: 32652
Dse
Name: dermatan sulfate epimerase
Synonyms: B130024B19Rik, Sart2, DS-epi1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212898
VEGA: 10
Homologene: 8354
Zcchc2
Name: zinc finger, CCHC domain containing 2
Synonyms: 9930114B20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227449
Homologene: 9808
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b1565Clo, b2b3491Clo, Mdnah5, b2b1154Clo, b2b1537Clo, Dnahc5, b2b1134Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Efhc1
Name: EF-hand domain (C-terminal) containing 1
Synonyms: myoclonin1, mRib72-1, 1700029F22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71877
Homologene: 10003
Unc13b
Name: unc-13 homolog B
Synonyms: Munc13-2, Unc13h2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Hek, Hek4, Mek4, End3, Cek4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Tubgcp6
Name: tubulin, gamma complex component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328580
Homologene: 32477
Ralgapa2
Name: Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms: AS250, RGC2, A230067G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241694
Homologene: 28131
Pter
Name: phosphotriesterase related
Synonyms: Mpr56-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19212
HGNC: HGNC:9590
Homologene: 7495
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Dock3
Name: dedicator of cyto-kinesis 3
Synonyms: PBP, Moca
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208869
HGNC: HGNC:2989
Homologene: 21030
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Or6d13
Name: olfactory receptor family 6 subfamily D member 13
Synonyms: GA_x54KRFPKN04-58174409-58175392, MOR119-3, Olfr213
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258020
Homologene: 74186
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245026
Homologene: 18260
Sema4f
Name: sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
Synonyms: Sema W
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20355
Homologene: 3147
Plbd2
Name: phospholipase B domain containing 2
Synonyms: p76, 66.3 kDa, 1300012G16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71772
Homologene: 41528
Cytip
Name: cytohesin 1 interacting protein
Synonyms: Pscdbp, Cybr, A130053M09Rik, Cbp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227929
HGNC: HGNC:9506
Homologene: 3167
Cdh24
Name: cadherin-like 24
Synonyms: EY-cadherin, 1700040A22Rik, ENSMUSG00000022188, cadherin 14-like
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239096
VEGA: 14
Homologene: 56951
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621430
Homologene: 115466
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Mical2
Name: microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms: 5330438E18Rik, Micalcl, 4921517J23Rik, Ebitein1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320878
Homologene: 8760
Ppp1r15b
Name: protein phosphatase 1, regulatory subunit 15B
Synonyms: CReP, C530022L24Rik, 1810033K10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108954
Homologene: 13134
Myo1a
Name: myosin IA
Synonyms: brush border myosin 1, Myhl, BBM-I
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Clec2m
Name: C-type lectin domain family 2, member m
Synonyms: 4922502D21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381816
Homologene: 77865
Amer3
Name: APC membrane recruitment 3
Synonyms: Fam123c, 9430069J07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211383
Homologene: 51888
Myod1
Name: myogenic differentiation 1
Synonyms: Myod-1, MyoD, MYF3, bHLHc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17927
HGNC: HGNC:7611
Homologene: 7857
Krtap5-1
Name: keratin associated protein 5-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50774
Gemin6
Name: gem nuclear organelle associated protein 6
Synonyms: 2810470M17Rik, 2610019B15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67242
Homologene: 11711
Lrriq4
Name: leucine-rich repeats and IQ motif containing 4
Synonyms: 4930558O21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68307
Homologene: 12260
S1pr4
Name: sphingosine-1-phosphate receptor 4
Synonyms: lpC1, S1P4, Edg6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13611
VEGA: 10
HGNC: HGNC:3170
Homologene: 2799
Vmn1r77
Name: vomeronasal 1 receptor 77
Synonyms: Gm6935
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628946
Homologene: 103843
Cdk14
Name: cyclin dependent kinase 14
Synonyms: Pftk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18647
HGNC: HGNC:8883
Homologene: 7888
Itfg2
Name: integrin alpha FG-GAP repeat containing 2
Synonyms: 2700050P07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101142
Homologene: 10211
Zfp354c
Name: zinc finger protein 354C
Synonyms: AJ18, 5330421P20Rik, Kid3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30944
Homologene: 56606
Mipep
Name: mitochondrial intermediate peptidase
Synonyms: 5730405E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70478
VEGA: 14
HGNC: HGNC:7104
Homologene: 4337
Ccdc177
Name: coiled-coil domain containing 177
Synonyms: LOC380768, Gm1568
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380768
VEGA: 12
Homologene: 128326
Gatd3a
Name: glutamine amidotransferase like class 1 domain containing 3A
Synonyms: D10Jhu81e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28295
VEGA: 10
HGNC: HGNC:1273
Homologene: 3416
Ttc12
Name: tetratricopeptide repeat domain 12
Synonyms: E330017O07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235330
Homologene: 32375
Ppargc1a
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
Synonyms: Pgc-1alphaa, Pgco1, Pgc1, Gm11133, A830037N07Rik, PPAR Gamma Coactivator-1, Pgc-1alpha
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19017
HGNC: HGNC:9237
Homologene: 7485
Spink2
Name: serine peptidase inhibitor, Kazal type 2
Synonyms: HUSI-II, acrosin-trypsin inhibitor, 1700007F22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69982
Homologene: 134017
Rps2
Name: ribosomal protein S2
Synonyms: Rps2, Llrep3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16898
Homologene: 37714
Kif19b
Name: kinesin family member 19B
Synonyms: Gm4869
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 101055939
Homologene: 82478
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 20,967,349 bp
  • A to T, chromosome 1 at 34,587,384 bp
  • A to G, chromosome 1 at 106,031,268 bp
  • A to T, chromosome 1 at 133,136,768 bp
  • T to C, chromosome 2 at 12,980,530 bp
  • G to A, chromosome 2 at 58,147,875 bp
  • A to G, chromosome 2 at 120,703,618 bp
  • A to G, chromosome 2 at 146,424,811 bp
  • A to T, chromosome 3 at 30,650,939 bp
  • T to A, chromosome 3 at 145,127,997 bp
  • T to A, chromosome 4 at 43,235,207 bp
  • T to C, chromosome 4 at 100,334,518 bp
  • T to C, chromosome 4 at 133,063,818 bp
  • G to A, chromosome 4 at 148,618,298 bp
  • T to G, chromosome 5 at 5,010,862 bp
  • A to G, chromosome 5 at 51,473,893 bp
  • C to T, chromosome 5 at 77,209,768 bp
  • A to G, chromosome 5 at 114,365,860 bp
  • A to T, chromosome 5 at 120,486,663 bp
  • T to C, chromosome 5 at 137,474,412 bp
  • C to A, chromosome 5 at 140,486,779 bp
  • A to T, chromosome 6 at 82,914,100 bp
  • G to A, chromosome 6 at 116,541,225 bp
  • T to C, chromosome 6 at 128,417,705 bp
  • T to C, chromosome 6 at 129,331,531 bp
  • T to A, chromosome 7 at 12,042,133 bp
  • A to G, chromosome 7 at 46,377,063 bp
  • T to C, chromosome 7 at 86,996,504 bp
  • GCG to GCGACGGCGCCG, chromosome 7 at 97,579,907 bp
  • A to G, chromosome 7 at 112,311,367 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • T to C, chromosome 9 at 49,440,215 bp
  • T to C, chromosome 9 at 86,524,351 bp
  • T to C, chromosome 9 at 105,786,149 bp
  • T to C, chromosome 9 at 106,978,728 bp
  • C to A, chromosome 9 at 107,635,127 bp
  • A to T, chromosome 10 at 34,153,938 bp
  • G to T, chromosome 10 at 77,113,210 bp
  • A to G, chromosome 10 at 78,169,627 bp
  • G to A, chromosome 10 at 81,498,699 bp
  • A to G, chromosome 10 at 89,414,420 bp
  • G to A, chromosome 10 at 127,712,784 bp
  • A to T, chromosome 11 at 50,817,891 bp
  • G to T, chromosome 11 at 72,753,643 bp
  • G to T, chromosome 11 at 78,969,890 bp
  • G to T, chromosome 11 at 117,812,681 bp
  • T to C, chromosome 12 at 54,985,839 bp
  • A to G, chromosome 12 at 80,757,434 bp
  • C to A, chromosome 14 at 54,632,417 bp
  • C to T, chromosome 14 at 54,663,715 bp
  • T to A, chromosome 14 at 60,843,240 bp
  • T to A, chromosome 14 at 123,409,787 bp
  • T to C, chromosome 15 at 28,459,356 bp
  • A to G, chromosome 15 at 89,122,621 bp
  • T to C, chromosome 15 at 90,225,690 bp
  • T to C, chromosome 16 at 57,122,183 bp
  • T to A, chromosome 16 at 63,610,985 bp
  • A to G, chromosome 16 at 91,656,846 bp
  • A to G, chromosome 17 at 24,721,688 bp
  • A to T, chromosome 17 at 25,568,071 bp
  • G to A, chromosome 17 at 80,228,003 bp
  • A to G, chromosome 18 at 10,555,042 bp
  • C to T, chromosome 19 at 17,120,146 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8862 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068741-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.