Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8862Btlr/Mmmh
Stock Number:
068741-MU
Citation ID:
RRID:MMRRC_068741-MU
Other Names:
R8862 (G1)
Major Collection:

Strain Information

Alg10
Name: ALG10 alpha-1,2-glucosyltransferase
Synonyms: Deaf1, LOC380959, nse5, Alg10b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380959
VEGA: 15
Homologene: 6030
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Gnai2
Name: G protein subunit alpha i2
Synonyms: Gia, Gnai-2, Galphai2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14678
HGNC: HGNC:4385
Homologene: 55539
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Lgals9
Name: lectin, galactose binding, soluble 9
Synonyms: LGALS35, galectin-9, gal-9, Lgals5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16859
Homologene: 134662
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, D9Ertd809e, Dopey1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 20,967,349 bp
  • A to T, chromosome 1 at 34,587,384 bp
  • A to G, chromosome 1 at 106,031,268 bp
  • A to T, chromosome 1 at 133,136,768 bp
  • T to C, chromosome 2 at 12,980,530 bp
  • G to A, chromosome 2 at 58,147,875 bp
  • A to G, chromosome 2 at 120,703,618 bp
  • A to G, chromosome 2 at 146,424,811 bp
  • A to T, chromosome 3 at 30,650,939 bp
  • T to A, chromosome 3 at 145,127,997 bp
  • T to A, chromosome 4 at 43,235,207 bp
  • T to C, chromosome 4 at 100,334,518 bp
  • T to C, chromosome 4 at 133,063,818 bp
  • G to A, chromosome 4 at 148,618,298 bp
  • T to G, chromosome 5 at 5,010,862 bp
  • A to G, chromosome 5 at 51,473,893 bp
  • C to T, chromosome 5 at 77,209,768 bp
  • A to G, chromosome 5 at 114,365,860 bp
  • A to T, chromosome 5 at 120,486,663 bp
  • T to C, chromosome 5 at 137,474,412 bp
  • C to A, chromosome 5 at 140,486,779 bp
  • A to T, chromosome 6 at 82,914,100 bp
  • G to A, chromosome 6 at 116,541,225 bp
  • T to C, chromosome 6 at 128,417,705 bp
  • T to C, chromosome 6 at 129,331,531 bp
  • T to A, chromosome 7 at 12,042,133 bp
  • A to G, chromosome 7 at 46,377,063 bp
  • T to C, chromosome 7 at 86,996,504 bp
  • GCG to GCGACGGCGCCG, chromosome 7 at 97,579,907 bp
  • A to G, chromosome 7 at 112,311,367 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • T to C, chromosome 9 at 49,440,215 bp
  • T to C, chromosome 9 at 86,524,351 bp
  • T to C, chromosome 9 at 105,786,149 bp
  • T to C, chromosome 9 at 106,978,728 bp
  • C to A, chromosome 9 at 107,635,127 bp
  • A to T, chromosome 10 at 34,153,938 bp
  • G to T, chromosome 10 at 77,113,210 bp
  • A to G, chromosome 10 at 78,169,627 bp
  • G to A, chromosome 10 at 81,498,699 bp
  • A to G, chromosome 10 at 89,414,420 bp
  • G to A, chromosome 10 at 127,712,784 bp
  • A to T, chromosome 11 at 50,817,891 bp
  • G to T, chromosome 11 at 72,753,643 bp
  • G to T, chromosome 11 at 78,969,890 bp
  • G to T, chromosome 11 at 117,812,681 bp
  • T to C, chromosome 12 at 54,985,839 bp
  • A to G, chromosome 12 at 80,757,434 bp
  • C to A, chromosome 14 at 54,632,417 bp
  • C to T, chromosome 14 at 54,663,715 bp
  • T to A, chromosome 14 at 60,843,240 bp
  • T to A, chromosome 14 at 123,409,787 bp
  • T to C, chromosome 15 at 28,459,356 bp
  • A to G, chromosome 15 at 89,122,621 bp
  • T to C, chromosome 15 at 90,225,690 bp
  • T to C, chromosome 16 at 57,122,183 bp
  • T to A, chromosome 16 at 63,610,985 bp
  • A to G, chromosome 16 at 91,656,846 bp
  • A to G, chromosome 17 at 24,721,688 bp
  • A to T, chromosome 17 at 25,568,071 bp
  • G to A, chromosome 17 at 80,228,003 bp
  • A to G, chromosome 18 at 10,555,042 bp
  • C to T, chromosome 19 at 17,120,146 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8862 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068741-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.