Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8891Btlr/Mmmh
Stock Number:
068753-MU
Citation ID:
RRID:MMRRC_068753-MU
Other Names:
R8891 (G1)
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75137
Homologene: 19997
Abtb3
Name: ankyrin repeat and BTB domain containing 3
Synonyms: 6330404E16Rik, Btbd11
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74007
Homologene: 72536
Gck
Name: glucokinase
Synonyms: hexokinase 4, MODY2, HK4, Gls006, Hlb62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103988
HGNC: HGNC:4195
Homologene: 55440
Kif13b
Name: kinesin family member 13B
Synonyms: GAKIN, N-3 kinesin, C130021D12Rik, 5330429L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Twsg1
Name: twisted gastrulation BMP signaling modulator 1
Synonyms: Tsg, 9030422N06Rik, D17Ertd403e, 1810013J15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 65960
VEGA: 17
Homologene: 10774
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: D330024H06Rik, A930031B09Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
H13
Name: histocompatibility 13
Synonyms: H-13, 1200006O09Rik, 5031424B04Rik, 4930443L17Rik, Spp, Hm13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14950
Homologene: 7749
Zfp59
Name: zinc finger protein 59
Synonyms: Mfg-2, Mfg2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22717
Homologene: 137243
Coa6
Name: cytochrome c oxidase assembly factor 6
Synonyms: 1810063B05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67892
Homologene: 65283
Pcdhb18
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Sucnr1
Name: succinate receptor 1
Synonyms: Gpr91
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84112
HGNC: HGNC:4542
Homologene: 41865
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, Ip3r3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Sag
Name: S-antigen, retina and pineal gland (arrestin)
Synonyms: A930001K18Rik, rod arrestin, Arr1, arrestin 1, visual arrestin 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20215
Homologene: 455
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, Catnd2, neurojugin, catenin (cadherin associated protein), delta 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Zfp429
Name: zinc finger protein 429
Synonyms: 2810487A22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72807
Homologene: 110878
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Phf7
Name: PHD finger protein 7
Synonyms: 1700010P14Rik, 1700006H01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71838
VEGA: 14
Homologene: 69217
Ankrd34c
Name: ankyrin repeat domain 34C
Synonyms: LOC330998, B230218L05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330998
Homologene: 19814
Gm5114
Name: predicted gene 5114
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330513
Homologene: 45597
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Tbx3
Name: T-box 3
Synonyms: D5Ertd189e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21386
Homologene: 4371
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
L3mbtl4
Name: L3MBTL4 histone methyl-lysine binding protein
Synonyms: D930040M24Rik, A730037L19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320858
Homologene: 114383
Slco1b2
Name: solute carrier organic anion transporter family, member 1b2
Synonyms: mlst-1, Slc21a6, Slc21a10, Oatp1b2, 7330442B20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28253
Homologene: 75119
Omg
Name: oligodendrocyte myelin glycoprotein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18377
HGNC: HGNC:8135
Homologene: 36099
Mul1
Name: mitochondrial ubiquitin ligase activator of NFKB 1
Synonyms: 0610009K11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68350
Homologene: 11576
Fbxo17
Name: F-box protein 17
Synonyms: Fbx17, FBXO26, Fbg4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50760
Homologene: 17523
Asap2
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms: LOC385250, Ddef2, 6530401G17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211914
HGNC: HGNC:2721
Homologene: 2888
Pcdhb14
Name: protocadherin beta 14
Synonyms: Pcdhb17, PcdhbN, 2210006M07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93885
Homologene: 70876
Sec16b
Name: SEC16 homolog B, endoplasmic reticulum export factor
Synonyms: Rgpr-p117, Rgpr, Lztr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 89867
Homologene: 13227
Or4k52
Name: olfactory receptor family 4 subfamily K member 52
Synonyms: GA_x6K02T2Q125-72831562-72832500, MOR248-3, Olfr1302
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258891
Homologene: 27290
Gnat2
Name: G protein subunit alpha transducin 2
Synonyms: Gnat-2, Tcalpha, Gt-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14686
HGNC: HGNC:4394
Homologene: 21092
Meioc
Name: meiosis specific with coiled-coil domain
Synonyms: LOC380729, LOC268491, Gm1564
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268491
Homologene: 19559
Rbm44
Name: RNA binding motif protein 44
Synonyms: LOC329207
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329207
Homologene: 66636
Zfp184
Name: zinc finger protein 184 (Kruppel-like)
Synonyms: 4930500C15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 193452
Homologene: 113602
Or2a52
Name: olfactory receptor family 2 subfamily A member 52
Synonyms: GA_x6K02T2P3E9-4391088-4390156, MOR261-11, Olfr437
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258293
HGNC: HGNC:8230
Homologene: 122778
Oas1c
Name: 2'-5' oligoadenylate synthetase 1C
Synonyms: Oasl5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114643
HGNC: HGNC:8086
Homologene: 110815
Chmp2a
Name: charged multivesicular body protein 2A
Synonyms: 1500016L11Rik, chromatin modifying protein 2A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68953
Homologene: 6382
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239853
Homologene: 13115
Galntl6
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms: 1700021K10Rik, 4930431L04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270049
Homologene: 65137
Crybb2
Name: crystallin, beta B2
Synonyms: betaB2-crystallin, Cryb-2, Aey2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12961
HGNC: HGNC:2398
Homologene: 420
Qdpr
Name: quinoid dihydropteridine reductase
Synonyms: 2610008L04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 110391
HGNC: HGNC:9752
Homologene: 271
Lpo
Name: lactoperoxidase
Synonyms: 5830499B15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76113
HGNC: HGNC:6678
Homologene: 21240
Or6c88
Name: olfactory receptor family 6 subfamily C member 88
Synonyms: GA_x6K02T2PULF-11248702-11249664, MOR114-11, Olfr794
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258375
Homologene: 45066
Cldn24
Name: claudin 24
Synonyms: Gm10107
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100039801
Homologene: 136011
Tigd5
Name: tigger transposable element derived 5
Synonyms: FLJ14926
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105734
Homologene: 129878
Tle7
Name: TLE family member 7
Synonyms: Gm21964
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102638837
VEGA: 8
Homologene: 131708
Eid3
Name: EP300 interacting inhibitor of differentiation 3
Synonyms: 1700027M21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66341
Homologene: 81651
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 44,057,124 bp
  • T to A, chromosome 1 at 87,831,961 bp
  • T to A, chromosome 1 at 91,162,414 bp
  • T to A, chromosome 1 at 157,554,839 bp
  • C to T, chromosome 1 at 172,119,251 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • T to C, chromosome 2 at 22,971,250 bp
  • G to A, chromosome 2 at 94,362,419 bp
  • A to T, chromosome 2 at 111,780,841 bp
  • A to G, chromosome 2 at 152,704,129 bp
  • A to T, chromosome 2 at 168,955,163 bp
  • A to G, chromosome 3 at 60,086,842 bp
  • A to C, chromosome 3 at 95,764,055 bp
  • G to A, chromosome 3 at 108,098,318 bp
  • A to T, chromosome 3 at 138,066,759 bp
  • A to C, chromosome 4 at 138,434,853 bp
  • C to T, chromosome 4 at 144,372,827 bp
  • T to C, chromosome 5 at 45,447,640 bp
  • G to A, chromosome 5 at 113,062,047 bp
  • A to G, chromosome 5 at 119,671,918 bp
  • C to T, chromosome 5 at 120,808,061 bp
  • A to G, chromosome 6 at 43,167,816 bp
  • T to C, chromosome 6 at 141,683,267 bp
  • T to A, chromosome 7 at 13,033,913 bp
  • T to A, chromosome 7 at 27,854,888 bp
  • G to T, chromosome 7 at 28,735,308 bp
  • C to A, chromosome 7 at 39,408,294 bp
  • G to GACGGCGGCT, chromosome 7 at 97,579,909 bp
  • A to T, chromosome 8 at 47,822,246 bp
  • T to C, chromosome 8 at 57,962,399 bp
  • A to T, chromosome 8 at 70,781,157 bp
  • C to A, chromosome 8 at 85,084,455 bp
  • T to A, chromosome 8 at 110,110,131 bp
  • G to C, chromosome 8 at 126,422,831 bp
  • T to G, chromosome 9 at 89,730,090 bp
  • A to G, chromosome 9 at 95,905,760 bp
  • G to A, chromosome 10 at 8,727,970 bp
  • A to G, chromosome 10 at 82,867,158 bp
  • G to A, chromosome 10 at 85,388,094 bp
  • A to G, chromosome 10 at 129,571,177 bp
  • A to ATCTTCCCAAAGCCAGTGC, chromosome 11 at 3,153,384 bp
  • G to T, chromosome 11 at 5,901,733 bp
  • T to A, chromosome 11 at 79,503,003 bp
  • T to A, chromosome 11 at 87,807,022 bp
  • T to A, chromosome 11 at 102,668,420 bp
  • T to A, chromosome 11 at 107,662,016 bp
  • C to T, chromosome 12 at 21,112,143 bp
  • G to A, chromosome 13 at 11,799,882 bp
  • A to G, chromosome 13 at 13,712,850 bp
  • T to C, chromosome 13 at 21,959,342 bp
  • A to T, chromosome 13 at 67,390,711 bp
  • C to A, chromosome 14 at 31,249,656 bp
  • A to G, chromosome 14 at 64,744,877 bp
  • A to T, chromosome 15 at 30,619,930 bp
  • T to C, chromosome 15 at 75,911,220 bp
  • G to T, chromosome 15 at 85,937,993 bp
  • T to A, chromosome 16 at 56,752,399 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • A to G, chromosome 17 at 65,948,662 bp
  • T to C, chromosome 17 at 68,455,786 bp
  • T to A, chromosome 18 at 37,449,639 bp
  • C to A, chromosome 18 at 37,490,647 bp
  • G to A, chromosome 19 at 25,410,075 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8891 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068753-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.