Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8891Btlr/Mmmh
Stock Number:
068753-MU
Citation ID:
RRID:MMRRC_068753-MU
Other Names:
R8891 (G1)
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75137
Homologene: 19997
Abtb3
Name: ankyrin repeat and BTB domain containing 3
Synonyms: 6330404E16Rik, Btbd11
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74007
Homologene: 72536
Gck
Name: glucokinase
Synonyms: hexokinase 4, MODY2, HK4, Gls006, Hlb62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103988
HGNC: HGNC:4195
Homologene: 55440
Kif13b
Name: kinesin family member 13B
Synonyms: GAKIN, N-3 kinesin, C130021D12Rik, 5330429L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 44,057,124 bp
  • T to A, chromosome 1 at 87,831,961 bp
  • T to A, chromosome 1 at 91,162,414 bp
  • T to A, chromosome 1 at 157,554,839 bp
  • C to T, chromosome 1 at 172,119,251 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • T to C, chromosome 2 at 22,971,250 bp
  • G to A, chromosome 2 at 94,362,419 bp
  • A to T, chromosome 2 at 111,780,841 bp
  • A to G, chromosome 2 at 152,704,129 bp
  • A to T, chromosome 2 at 168,955,163 bp
  • A to G, chromosome 3 at 60,086,842 bp
  • A to C, chromosome 3 at 95,764,055 bp
  • G to A, chromosome 3 at 108,098,318 bp
  • A to T, chromosome 3 at 138,066,759 bp
  • A to C, chromosome 4 at 138,434,853 bp
  • C to T, chromosome 4 at 144,372,827 bp
  • T to C, chromosome 5 at 45,447,640 bp
  • G to A, chromosome 5 at 113,062,047 bp
  • A to G, chromosome 5 at 119,671,918 bp
  • C to T, chromosome 5 at 120,808,061 bp
  • A to G, chromosome 6 at 43,167,816 bp
  • T to C, chromosome 6 at 141,683,267 bp
  • T to A, chromosome 7 at 13,033,913 bp
  • T to A, chromosome 7 at 27,854,888 bp
  • G to T, chromosome 7 at 28,735,308 bp
  • C to A, chromosome 7 at 39,408,294 bp
  • G to GACGGCGGCT, chromosome 7 at 97,579,909 bp
  • A to T, chromosome 8 at 47,822,246 bp
  • T to C, chromosome 8 at 57,962,399 bp
  • A to T, chromosome 8 at 70,781,157 bp
  • C to A, chromosome 8 at 85,084,455 bp
  • T to A, chromosome 8 at 110,110,131 bp
  • G to C, chromosome 8 at 126,422,831 bp
  • T to G, chromosome 9 at 89,730,090 bp
  • A to G, chromosome 9 at 95,905,760 bp
  • G to A, chromosome 10 at 8,727,970 bp
  • A to G, chromosome 10 at 82,867,158 bp
  • G to A, chromosome 10 at 85,388,094 bp
  • A to G, chromosome 10 at 129,571,177 bp
  • A to ATCTTCCCAAAGCCAGTGC, chromosome 11 at 3,153,384 bp
  • G to T, chromosome 11 at 5,901,733 bp
  • T to A, chromosome 11 at 79,503,003 bp
  • T to A, chromosome 11 at 87,807,022 bp
  • T to A, chromosome 11 at 102,668,420 bp
  • T to A, chromosome 11 at 107,662,016 bp
  • C to T, chromosome 12 at 21,112,143 bp
  • G to A, chromosome 13 at 11,799,882 bp
  • A to G, chromosome 13 at 13,712,850 bp
  • T to C, chromosome 13 at 21,959,342 bp
  • A to T, chromosome 13 at 67,390,711 bp
  • C to A, chromosome 14 at 31,249,656 bp
  • A to G, chromosome 14 at 64,744,877 bp
  • A to T, chromosome 15 at 30,619,930 bp
  • T to C, chromosome 15 at 75,911,220 bp
  • G to T, chromosome 15 at 85,937,993 bp
  • T to A, chromosome 16 at 56,752,399 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • A to G, chromosome 17 at 65,948,662 bp
  • T to C, chromosome 17 at 68,455,786 bp
  • T to A, chromosome 18 at 37,449,639 bp
  • C to A, chromosome 18 at 37,490,647 bp
  • G to A, chromosome 19 at 25,410,075 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8891 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068753-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.