Strain Name:
C57BL/6J-MtgxR8904Btlr/Mmmh
Stock Number:
068761-MU
Citation ID:
RRID:MMRRC_068761-MU
Other Names:
R8904 (G1)
Major Collection:

Strain Information

Pde1c
Name: phosphodiesterase 1C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18575
HGNC: HGNC:8776
Homologene: 3682
Grm1
Name: glutamate receptor, metabotropic 1
Synonyms: rcw, mGluR1, nmf373, Grm1, 4930455H15Rik, Gprc1a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14816
HGNC: HGNC:4593
Homologene: 649
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: Edd, Edd1, 4432411E13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNAPDcs, DNA-PK, slip, XRCC7, DNA-PKcs, dxnph, DOXNPH
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: D5Bwg1524e, Rutbc2, 2410098H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Igll1
Name: immunoglobulin lambda-like polypeptide 1
Synonyms: Lambda 5, Igl-5, Igll
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16136
Homologene: 131669
Epb41l5
Name: erythrocyte membrane protein band 4.1 like 5
Synonyms: 1700030C16Rik, E230025E14Rik, Lulu1, Epb4.1l5, NBL5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226352
Homologene: 32492
Prim2
Name: DNA primase, p58 subunit
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19076
HGNC: HGNC:9370
Homologene: 731
Schip1
Name: schwannomin interacting protein 1
Synonyms: SCHIP-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30953
Homologene: 130673
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: D2Xrf87, Bub1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Cnot10
Name: CCR4-NOT transcription complex, subunit 10
Synonyms: 2600001P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78893
VEGA: 9
Homologene: 41040
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: ERa, ERalpha, ER[a], ESR, ER-alpha, Estr, Nr3a1, Estra
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Osbpl11
Name: oxysterol binding protein-like 11
Synonyms: ORP-11
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106326
Homologene: 23385
Aqr
Name: aquarius
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11834
Homologene: 7629
Sema4d
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: CD100, M-sema G, Semcl2, Semaj, Semacl2, coll-4, semaphorin H
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20354
Homologene: 21282
Amotl1
Name: angiomotin-like 1
Synonyms: 2310067L22Rik, JEAP, 4932416D09Rik, 2310010G08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Mib2
Name: mindbomb E3 ubiquitin protein ligase 2
Synonyms: 2210008I11Rik, Zzank1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76580
Homologene: 16062
Adcy1
Name: adenylate cyclase 1
Synonyms: D11Bwg1392e, I-AC, AC1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Tsr1
Name: TSR1 20S rRNA accumulation
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104662
Homologene: 5576
Atp2b1
Name: ATPase, Ca++ transporting, plasma membrane 1
Synonyms: PMCA1, 2810442I22Rik, E130111D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67972
VEGA: 10
HGNC: HGNC:814
Homologene: 55597
Pprc1
Name: peroxisome proliferative activated receptor, gamma, coactivator-related 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226169
Homologene: 9006
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: 9930021N24Rik, MOZ, Myst3, Zfp220
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Ret
Name: ret proto-oncogene
Synonyms: RET51, c-Ret, RET9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19713
HGNC: HGNC:9967
Homologene: 7517
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Clic5
Name: chloride intracellular channel 5
Synonyms: 5730531E12Rik, nmf318
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224796
VEGA: 17
Homologene: 987
Unc13b
Name: unc-13 homolog B
Synonyms: Munc13-2, Unc13h2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Ccdc38
Name: coiled-coil domain containing 38
Synonyms: 4933417K05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237465
Homologene: 52182
Cul9
Name: cullin 9
Synonyms: Parc, 1810035I07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Tril
Name: TLR4 interactor with leucine-rich repeats
Synonyms: 1200009O22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66873
Homologene: 69404
Prg4
Name: proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms: MSF, DOL54, SZP, lubricin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 96875
HGNC: HGNC:9364
Homologene: 137352
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329421
Homologene: 51393
Pign
Name: phosphatidylinositol glycan anchor biosynthesis, class N
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27392
HGNC: HGNC:8967
Homologene: 6330
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM25H2, SM2SH2, Fbw10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 213980
Homologene: 32757
Atp9a
Name: ATPase, class II, type 9A
Synonyms: IIa, Class II
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Mmut
Name: methylmalonyl-Coenzyme A mutase
Synonyms: Mut, D230010K02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17850
VEGA: 17
HGNC: HGNC:7526
Homologene: 20097
Hsd17b3
Name: hydroxysteroid (17-beta) dehydrogenase 3
Synonyms: 17(beta)HSD type 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15487
VEGA: 13
HGNC: HGNC:5212
Homologene: 20089
Macrod1
Name: mono-ADP ribosylhydrolase 1
Synonyms: D930010J01Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107227
VEGA: 19
Homologene: 8549
Ampd1
Name: adenosine monophosphate deaminase 1
Synonyms: Ampd-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229665
HGNC: HGNC:468
Homologene: 20
Mpl
Name: myeloproliferative leukemia virus oncogene
Synonyms: TPO-R, hlb219, thrombopoietin receptor, c-mpl, c-mpl-II, c-mpl-I, CD110
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17480
HGNC: HGNC:7217
Homologene: 7845
Or7g33
Name: olfactory receptor family 7 subfamily G member 33
Synonyms: MOR154-1, Olfr853, GA_x6K02T2PVTD-13277703-13276786
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258908
HGNC: HGNC:8466
Homologene: 133623
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Or5b24
Name: olfactory receptor family 5 subfamily B member 24
Synonyms: MOR202-34, Olfr1449, GA_x6K02T2RE5P-3264213-3265157
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258300
Homologene: 17184
Prss40
Name: serine protease 40
Synonyms: Tesp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21756
Homologene: 69043
Or5p79
Name: olfactory receptor family 5 subfamily P member 79
Synonyms: MOR204-7, GA_x6K02T2PBJ9-10951546-10952496, Olfr507
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258738
Homologene: 27249
Cyp2c55
Name: cytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms: 2010318C06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72082
HGNC: HGNC:2620
Homologene: 133567
Tnfsf11
Name: tumor necrosis factor (ligand) superfamily, member 11
Synonyms: Ly109l, OPGL, osteoclast differentiation factor, Trance, RANKL, OPGL, ODF
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21943
VEGA: 14
Homologene: 2744
Krt36
Name: keratin 36
Synonyms: HRa-1, keratin 5, Krt1-5, Krt1-22
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16673
HGNC: HGNC:6454
Homologene: 88459
Tas1r2
Name: taste receptor, type 1, member 2
Synonyms: TR2, Gpr71, T1r2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83770
Homologene: 75323
Ajm1
Name: apical junction component 1
Synonyms: Gm996, LOC381353
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381353
Homologene: 19943
Or6s1
Name: olfactory receptor family 6 subfamily S member 1
Synonyms: MOR103-18, Olfr750, GA_x6K02T2PMLR-6808276-6807281
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 404319
Homologene: 19719
Entpd8
Name: ectonucleoside triphosphate diphosphohydrolase 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72090
Homologene: 77857
Nkx2-6
Name: NK2 homeobox 6
Synonyms: Tix, Nkx-2.6, Nkx2.6, tinman
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18092
Homologene: 22604
Ephb4
Name: Eph receptor B4
Synonyms: MDK2, b2b2412Clo, Htk, Myk1, Tyro11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Clec4a4
Name: C-type lectin domain family 4, member a4
Synonyms: Dcir2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 474145
Homologene: 133910
Gpr150
Name: G protein-coupled receptor 150
Synonyms: C030001A19Rik, PGR11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238725
Homologene: 18457
Hsbp1l1
Name: heat shock factor binding protein 1-like 1
Synonyms: 1810005K13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66255
VEGA: 18
Homologene: 122116
2510009E07Rik
Name: RIKEN cDNA 2510009E07 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72190
VEGA: 16
Homologene: 78167
Or1ab2
Name: olfactory receptor family 1 subfamily AB member 2
Synonyms: Olfr374, MOR130-1, GA_x6K02T2NUPS-241490-242431
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 258335
Homologene: 131127
Zfp606
Name: zinc finger protein 606
Synonyms: 2410022M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67370
Homologene: 23514
Or5d46
Name: olfactory receptor family 5 subfamily D member 46
Synonyms: Olfr1176, GA_x6K02T2Q125-49824309-49825256, MOR174-5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258767
Ccl27a
Name: C-C motif chemokine ligand 27A
Synonyms: ILC, CTACK, ESkine, Scya27a, CTAK, ALP, skinskine, Scya27, PESKY, ESkine, Ccl27, mILC
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20301
Homologene: 134761
Gm11110
Name: predicted gene 11110
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100169874
VEGA: 17
Hmx1
Name: H6 homeobox 1
Synonyms: Nkx5-3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15371
HGNC: HGNC:5017
Homologene: 49241
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,630,432 bp
  • C to T, chromosome 1 at 34,555,964 bp
  • G to A, chromosome 1 at 105,591,634 bp
  • A to G, chromosome 1 at 119,620,206 bp
  • C to A, chromosome 1 at 150,456,059 bp
  • A to C, chromosome 2 at 25,083,563 bp
  • A to T, chromosome 2 at 25,577,902 bp
  • A to G, chromosome 2 at 31,433,392 bp
  • C to A, chromosome 2 at 70,426,908 bp
  • T to G, chromosome 2 at 88,339,605 bp
  • T to A, chromosome 2 at 114,136,993 bp
  • T to A, chromosome 2 at 127,829,702 bp
  • A to T, chromosome 2 at 168,705,177 bp
  • T to C, chromosome 3 at 68,495,103 bp
  • A to G, chromosome 3 at 103,081,058 bp
  • A to T, chromosome 4 at 41,774,194 bp
  • A to G, chromosome 4 at 43,178,531 bp
  • G to A, chromosome 4 at 100,953,166 bp
  • A to G, chromosome 4 at 118,444,066 bp
  • T to C, chromosome 4 at 139,667,403 bp
  • A to G, chromosome 4 at 155,659,716 bp
  • T to A, chromosome 5 at 35,392,167 bp
  • G to T, chromosome 5 at 96,781,279 bp
  • C to T, chromosome 5 at 113,273,629 bp
  • T to A, chromosome 5 at 137,370,805 bp
  • C to T, chromosome 6 at 53,820,217 bp
  • A to T, chromosome 6 at 56,179,143 bp
  • C to T, chromosome 6 at 118,180,213 bp
  • T to C, chromosome 6 at 123,013,877 bp
  • A to G, chromosome 7 at 12,489,579 bp
  • A to G, chromosome 7 at 108,622,712 bp
  • A to G, chromosome 8 at 22,938,808 bp
  • A to G, chromosome 8 at 72,110,432 bp
  • T to C, chromosome 9 at 14,558,565 bp
  • A to T, chromosome 9 at 19,537,464 bp
  • A to G, chromosome 9 at 62,757,611 bp
  • A to T, chromosome 9 at 114,601,355 bp
  • A to G, chromosome 10 at 4,746,654 bp
  • A to T, chromosome 10 at 10,719,537 bp
  • A to G, chromosome 10 at 93,575,335 bp
  • A to G, chromosome 10 at 98,969,004 bp
  • T to G, chromosome 11 at 7,109,075 bp
  • C to A, chromosome 11 at 62,875,005 bp
  • T to A, chromosome 11 at 74,899,391 bp
  • A to G, chromosome 11 at 100,105,347 bp
  • A to T, chromosome 13 at 51,700,899 bp
  • T to C, chromosome 13 at 64,064,380 bp
  • G to T, chromosome 13 at 76,056,409 bp
  • A to G, chromosome 14 at 51,071,208 bp
  • A to G, chromosome 14 at 69,171,971 bp
  • C to T, chromosome 14 at 78,278,679 bp
  • A to T, chromosome 15 at 36,025,981 bp
  • A to G, chromosome 15 at 38,041,909 bp
  • T to C, chromosome 16 at 15,727,726 bp
  • A to T, chromosome 16 at 16,863,712 bp
  • CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA to CCGGA, chromosome 16 at 21,653,398 bp
  • T to A, chromosome 16 at 33,227,237 bp
  • A to G, chromosome 17 at 40,937,393 bp
  • A to T, chromosome 17 at 44,242,105 bp
  • T to C, chromosome 17 at 46,520,501 bp
  • T to C, chromosome 17 at 57,103,439 bp
  • T to C, chromosome 18 at 80,235,470 bp
  • T to C, chromosome 19 at 7,197,020 bp
  • T to C, chromosome 19 at 12,934,828 bp
  • A to G, chromosome 19 at 39,034,372 bp
  • A to G, chromosome 19 at 46,071,744 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8904 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068761-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.