Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8904Btlr/Mmmh
Stock Number:
068761-MU
Citation ID:
RRID:MMRRC_068761-MU
Other Names:
R8904 (G1)
Major Collection:

Strain Information

Grm1
Name: glutamate receptor, metabotropic 1
Synonyms: mGluR1, Grm1, Gprc1a, nmf373, rcw, 4930455H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14816
HGNC: HGNC:4593
Homologene: 649
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Igll1
Name: immunoglobulin lambda-like polypeptide 1
Synonyms: Igll, Lambda 5, Igl-5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16136
Homologene: 131669
Epb41l5
Name: erythrocyte membrane protein band 4.1 like 5
Synonyms: NBL5, 1700030C16Rik, E230025E14Rik, Lulu1, Epb4.1l5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226352
Homologene: 32492
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,630,432 bp
  • C to T, chromosome 1 at 34,555,964 bp
  • G to A, chromosome 1 at 105,591,634 bp
  • A to G, chromosome 1 at 119,620,206 bp
  • C to A, chromosome 1 at 150,456,059 bp
  • A to C, chromosome 2 at 25,083,563 bp
  • A to T, chromosome 2 at 25,577,902 bp
  • A to G, chromosome 2 at 31,433,392 bp
  • C to A, chromosome 2 at 70,426,908 bp
  • T to G, chromosome 2 at 88,339,605 bp
  • T to A, chromosome 2 at 114,136,993 bp
  • T to A, chromosome 2 at 127,829,702 bp
  • A to T, chromosome 2 at 168,705,177 bp
  • T to C, chromosome 3 at 68,495,103 bp
  • A to G, chromosome 3 at 103,081,058 bp
  • A to T, chromosome 4 at 41,774,194 bp
  • A to G, chromosome 4 at 43,178,531 bp
  • G to A, chromosome 4 at 100,953,166 bp
  • A to G, chromosome 4 at 118,444,066 bp
  • T to C, chromosome 4 at 139,667,403 bp
  • A to G, chromosome 4 at 155,659,716 bp
  • T to A, chromosome 5 at 35,392,167 bp
  • G to T, chromosome 5 at 96,781,279 bp
  • C to T, chromosome 5 at 113,273,629 bp
  • T to A, chromosome 5 at 137,370,805 bp
  • C to T, chromosome 6 at 53,820,217 bp
  • A to T, chromosome 6 at 56,179,143 bp
  • C to T, chromosome 6 at 118,180,213 bp
  • T to C, chromosome 6 at 123,013,877 bp
  • A to G, chromosome 7 at 12,489,579 bp
  • A to G, chromosome 7 at 108,622,712 bp
  • A to G, chromosome 8 at 22,938,808 bp
  • A to G, chromosome 8 at 72,110,432 bp
  • T to C, chromosome 9 at 14,558,565 bp
  • A to T, chromosome 9 at 19,537,464 bp
  • A to G, chromosome 9 at 62,757,611 bp
  • A to T, chromosome 9 at 114,601,355 bp
  • A to G, chromosome 10 at 4,746,654 bp
  • A to T, chromosome 10 at 10,719,537 bp
  • A to G, chromosome 10 at 93,575,335 bp
  • A to G, chromosome 10 at 98,969,004 bp
  • T to G, chromosome 11 at 7,109,075 bp
  • C to A, chromosome 11 at 62,875,005 bp
  • T to A, chromosome 11 at 74,899,391 bp
  • A to G, chromosome 11 at 100,105,347 bp
  • A to T, chromosome 13 at 51,700,899 bp
  • T to C, chromosome 13 at 64,064,380 bp
  • G to T, chromosome 13 at 76,056,409 bp
  • A to G, chromosome 14 at 51,071,208 bp
  • A to G, chromosome 14 at 69,171,971 bp
  • C to T, chromosome 14 at 78,278,679 bp
  • A to T, chromosome 15 at 36,025,981 bp
  • A to G, chromosome 15 at 38,041,909 bp
  • T to C, chromosome 16 at 15,727,726 bp
  • A to T, chromosome 16 at 16,863,712 bp
  • CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA to CCGGA, chromosome 16 at 21,653,398 bp
  • T to A, chromosome 16 at 33,227,237 bp
  • A to G, chromosome 17 at 40,937,393 bp
  • A to T, chromosome 17 at 44,242,105 bp
  • T to C, chromosome 17 at 46,520,501 bp
  • T to C, chromosome 17 at 57,103,439 bp
  • T to C, chromosome 18 at 80,235,470 bp
  • T to C, chromosome 19 at 7,197,020 bp
  • T to C, chromosome 19 at 12,934,828 bp
  • A to G, chromosome 19 at 39,034,372 bp
  • A to G, chromosome 19 at 46,071,744 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8904 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068761-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.