Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8914Btlr/Mmmh
Stock Number:
068766-MU
Citation ID:
RRID:MMRRC_068766-MU
Other Names:
R8914 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Omd
Name: osteomodulin
Synonyms: osteoadherin, SLRR2C, OSAD
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27047
VEGA: 13
HGNC: HGNC:8134
Homologene: 3677
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Mthfd1
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: Mthfd, DCS, E430024A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108156
VEGA: 12
HGNC: HGNC:7432
Homologene: 55940
Ubxn2a
Name: UBX domain protein 2A
Synonyms: 6330407P03Rik, Ubxd4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217379
Homologene: 17076
Pou5f1
Name: POU domain, class 5, transcription factor 1
Synonyms: Oct4, Oct3/4, Oct-3/4, Otf4, Otf3, Otf3g, Otf3-rs7, Otf-4, Otf-3, Oct-4, Oct-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18999
Homologene: 8422
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 5730409A01Rik, 1810061H24Rik, SAP130, RSE1, D8Ertd633e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101943
Homologene: 6579
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 17,621,738 bp
  • C to T, chromosome 1 at 40,543,017 bp
  • T to A, chromosome 1 at 120,031,656 bp
  • A to G, chromosome 2 at 85,579,712 bp
  • A to C, chromosome 2 at 109,137,280 bp
  • C to A, chromosome 2 at 111,489,659 bp
  • C to T, chromosome 2 at 168,637,500 bp
  • T to C, chromosome 3 at 54,807,621 bp
  • A to T, chromosome 3 at 65,946,659 bp
  • T to G, chromosome 4 at 28,963,892 bp
  • T to C, chromosome 4 at 105,000,503 bp
  • G to T, chromosome 5 at 5,036,515 bp
  • T to A, chromosome 5 at 52,843,501 bp
  • A to T, chromosome 5 at 112,355,221 bp
  • T to A, chromosome 5 at 150,541,743 bp
  • A to C, chromosome 6 at 68,542,356 bp
  • C to T, chromosome 6 at 70,435,196 bp
  • T to A, chromosome 6 at 115,463,172 bp
  • T to C, chromosome 6 at 124,062,024 bp
  • C to A, chromosome 7 at 11,756,401 bp
  • A to T, chromosome 7 at 12,671,097 bp
  • C to T, chromosome 7 at 43,979,501 bp
  • A to G, chromosome 7 at 79,915,163 bp
  • T to C, chromosome 7 at 89,510,646 bp
  • C to A, chromosome 7 at 98,135,790 bp
  • T to A, chromosome 7 at 103,451,883 bp
  • C to T, chromosome 7 at 107,624,715 bp
  • A to G, chromosome 7 at 108,346,552 bp
  • T to C, chromosome 7 at 108,893,529 bp
  • A to G, chromosome 7 at 135,697,866 bp
  • A to G, chromosome 8 at 104,425,458 bp
  • T to A, chromosome 8 at 110,813,807 bp
  • C to G, chromosome 9 at 108,611,739 bp
  • T to A, chromosome 9 at 121,443,781 bp
  • C to A, chromosome 10 at 116,322,662 bp
  • C to A, chromosome 10 at 129,035,503 bp
  • A to G, chromosome 11 at 23,343,604 bp
  • A to T, chromosome 11 at 60,740,579 bp
  • A to T, chromosome 11 at 74,435,761 bp
  • A to T, chromosome 11 at 82,981,306 bp
  • A to T, chromosome 12 at 3,866,192 bp
  • T to C, chromosome 12 at 4,880,754 bp
  • T to A, chromosome 12 at 21,295,111 bp
  • C to A, chromosome 12 at 69,316,315 bp
  • T to A, chromosome 12 at 76,282,936 bp
  • G to T, chromosome 12 at 80,637,508 bp
  • A to G, chromosome 12 at 103,424,406 bp
  • C to A, chromosome 12 at 107,916,904 bp
  • T to C, chromosome 13 at 4,511,216 bp
  • T to A, chromosome 13 at 14,247,603 bp
  • A to G, chromosome 13 at 21,180,823 bp
  • A to G, chromosome 13 at 43,425,084 bp
  • A to T, chromosome 13 at 49,592,242 bp
  • A to G, chromosome 13 at 118,387,219 bp
  • G to A, chromosome 14 at 65,641,905 bp
  • C to A, chromosome 15 at 39,857,223 bp
  • T to A, chromosome 15 at 79,716,192 bp
  • C to T, chromosome 15 at 99,425,880 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 90,810,234 bp
  • C to T, chromosome 17 at 23,460,169 bp
  • T to G, chromosome 17 at 27,886,913 bp
  • T to C, chromosome 17 at 35,510,474 bp
  • A to T, chromosome 17 at 38,335,429 bp
  • C to A, chromosome 18 at 12,751,020 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8914 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068766-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.