Strain Name:
C57BL/6J-MtgxR8914Btlr/Mmmh
Stock Number:
068766-MU
Citation ID:
RRID:MMRRC_068766-MU
Other Names:
R8914 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Omd
Name: osteomodulin
Synonyms: OSAD, osteoadherin, SLRR2C
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27047
VEGA: 13
HGNC: HGNC:8134
Homologene: 3677
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Mdk1, Hek11, Ehk3, Cek11, Ebk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Mthfd1
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: Mthfd, E430024A07Rik, DCS
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108156
VEGA: 12
HGNC: HGNC:7432
Homologene: 55940
Ubxn2a
Name: UBX domain protein 2A
Synonyms: 6330407P03Rik, Ubxd4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217379
Homologene: 17076
Pou5f1
Name: POU domain, class 5, transcription factor 1
Synonyms: Otf3, Oct3/4, Oct-3/4, Oct-4, Otf-3, Oct4, Otf3g, Oct-3, Otf3-rs7, Otf-4, Otf4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18999
Homologene: 8422
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 1810061H24Rik, SAP130, 5730409A01Rik, D8Ertd633e, RSE1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101943
Homologene: 6579
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Bltp3a
Name: bridge-like lipid transfer protein family member 3A
Synonyms: F830021D11Rik, Uhrf1bp1, 1110020K19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224648
Homologene: 9816
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, Ki67, D630048A14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 4921511H13Rik, 5730405K23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Pparg
Name: peroxisome proliferator activated receptor gamma
Synonyms: Ppar-gamma2, PPARgamma2, PPARgamma, Nr1c3, PPAR-gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19016
HGNC: HGNC:9236
Homologene: 7899
Nemf
Name: nuclear export mediator factor
Synonyms: 4933405E14Rik, Sdccag1, 1500011I12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66244
VEGA: 12
Homologene: 3458
Trim27
Name: tripartite motif-containing 27
Synonyms: Rfp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19720
HGNC: HGNC:9975
Homologene: 111010
Nckap5l
Name: NCK-associated protein 5-like
Synonyms: C230021P08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380969
Homologene: 18924
Ap3s2
Name: adaptor-related protein complex 3, sigma 2 subunit
Synonyms: sigma 3B, [s]3B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11778
HGNC: HGNC:571
Homologene: 100592
Trak1
Name: trafficking protein, kinesin binding 1
Synonyms: hyrt, 2310001H13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67095
Homologene: 25103
Arih2
Name: ariadne RBR E3 ubiquitin protein ligase 2
Synonyms: TRIAD1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23807
HGNC: HGNC:690
Homologene: 48424
Dync1li2
Name: dynein, cytoplasmic 1 light intermediate chain 2
Synonyms: LIC2, Dlic2, Dncli2, Dnclic2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234663
HGNC: HGNC:2966
Homologene: 4474
Erh
Name: ERH mRNA splicing and mitosis factor
Synonyms: Mer, Prei1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13877
HGNC: HGNC:3447
Homologene: 3274
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Gtpbp1
Name: GTP binding protein 1
Synonyms: GP-1, GTPBP1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14904
VEGA: 15
HGNC: HGNC:4669
Homologene: 3165
Top3a
Name: topoisomerase (DNA) III alpha
Synonyms: Top IIIa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21975
Homologene: 3394
Ddx24
Name: DEAD box helicase 24
Synonyms: 2510027P10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 24, 1700055J08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27225
VEGA: 12
Homologene: 10702
Cpsf3
Name: cleavage and polyadenylation specificity factor 3
Synonyms: 73 kDa
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54451
VEGA: 12
HGNC: HGNC:2326
Homologene: 6499
Dpys
Name: dihydropyrimidinase
Synonyms: 1300004I01Rik, 1200017I10Rik, DHPase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64705
HGNC: HGNC:3013
Homologene: 20359
Anapc4
Name: anaphase promoting complex subunit 4
Synonyms: D5Ertd249e, 2610306D21Rik, APC4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52206
Homologene: 40873
Rap1gap2
Name: RAP1 GTPase activating protein 2
Synonyms: Garnl4, LOC380710
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380711
Homologene: 56695
Sctr
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319229
Homologene: 68290
Vmn1r73
Name: vomeronasal 1 receptor 73
Synonyms: V1rg2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171237
Homologene: 103842
Mrps30
Name: mitochondrial ribosomal protein S30
Synonyms: 2610020A16Rik, Pdcd9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 59054
HGNC: HGNC:8769
Homologene: 9607
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56552
Homologene: 135915
Bcl11b
Name: B cell leukemia/lymphoma 11B
Synonyms: 9130430L19Rik, Rit1, COUP-TF interacting protein 2, CTIP2, B630002E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58208
Homologene: 10974
Fyb2
Name: FYN binding protein 2
Synonyms: 1700024P16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242594
Homologene: 52981
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: SLIP-GC, LOC239151, Gm600
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Atp9a
Name: ATPase, class II, type 9A
Synonyms: IIa, Class II
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Vmn2r55
Name: vomeronasal 2, receptor 55
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042499
Homologene: 104040
Akr1c20
Name: aldo-keto reductase family 1, member C20
Synonyms: 2610528B18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 116852
Capn5
Name: calpain 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12337
HGNC: HGNC:1482
Homologene: 31212
Klk1b9
Name: kallikrein 1-related peptidase b9
Synonyms: Klk9, mGk-9, Egfbp-3, Egfbp3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13648
Homologene: 68141
Or5p68
Name: olfactory receptor family 5 subfamily P member 68
Synonyms: MOR204-35, Olfr493, GA_x6K02T2PBJ9-10676998-10676054
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258307
Homologene: 17188
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: GA_x6K02T2PSCP-2779375-2780313, MOR256-7, Olfr136
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: VE-PTP, 3230402H02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Vmn2r117
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619788
Homologene: 86604
Or51l14
Name: olfactory receptor family 51 subfamily L member 14
Synonyms: MOR17-2, GA_x6K02T2PBJ9-6173009-6173968, Olfr606
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259098
Homologene: 110570
Prss23
Name: serine protease 23
Synonyms: 2310046G15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76453
Homologene: 5191
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Cdk14
Name: cyclin dependent kinase 14
Synonyms: Pftk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18647
HGNC: HGNC:8883
Homologene: 7888
Ccdc121rt3
Name: coiled-coil domain containing 121, retrogene 3
Synonyms: Gm6583
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 625424
Homologene: 116059
Or5g27
Name: olfactory receptor family 5 subfamily G member 27
Synonyms: Olfr996, GA_x6K02T2Q125-47058060-47059004, MOR175-4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258429
Homologene: 85934
Cabyr
Name: calcium binding tyrosine phosphorylation regulated
Synonyms: CBP86, 1700016C01Rik, FSP-2, 4933421A18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71132
Homologene: 49299
Pi15
Name: peptidase inhibitor 15
Synonyms: P25TI, P24TI, SugarCrisp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94227
HGNC: HGNC:8946
Homologene: 22935
Hecw1
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms: NEDL1, E130207I19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94253
VEGA: 13
Homologene: 9004
Or4k42
Name: olfactory receptor family 4 subfamily K member 42
Synonyms: MOR248-9, GA_x6K02T2Q125-72541649-72540711, Olfr1290
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257662
Homologene: 74248
Or10a3n
Name: olfactory receptor family 10 subfamily A member 3N
Synonyms: Olfr519, MOR268-6, GA_x6K02T2PBJ9-11224559-11223615
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277935
Homologene: 17186
5330417H12Rik
Name: RIKEN cDNA 5330417H12 gene
Type: Gene
Species: Mouse
Chromosome: 7
Mettl15
Name: methyltransferase like 15
Synonyms: 0610027B03Rik, Mett5d1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76894
Homologene: 12661
Slfn9
Name: schlafen 9
Synonyms: 9830137M10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237886
Homologene: 45432
Ccnl1
Name: cyclin L1
Synonyms: 2610030E23Rik, ania-6a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56706
Homologene: 10541
Rfxap
Name: regulatory factor X-associated protein
Synonyms: 5730495K23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170767
HGNC: HGNC:9988
Homologene: 452
Igkv1-99
Name: immunoglobulin kappa variable 1-99
Synonyms: Gm16800
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434028
Igkv6-14
Name: immunoglobulin kappa variable 6-14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667881
HGNC: HGNC:5834
Or6c200-ps1
Name: olfactory receptor family 6 subfamily C member 200, pseudogene 1
Synonyms: Olfr764, Gm6349, GA_x6K02T00F4V-833-1750, GA_x6K02T2PULF-10720146-10719487, Olfr227, Olfr764-ps1, MOR115-6_p
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 622733
Homologene: 67771
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 17,621,738 bp
  • C to T, chromosome 1 at 40,543,017 bp
  • T to A, chromosome 1 at 120,031,656 bp
  • A to G, chromosome 2 at 85,579,712 bp
  • A to C, chromosome 2 at 109,137,280 bp
  • C to A, chromosome 2 at 111,489,659 bp
  • C to T, chromosome 2 at 168,637,500 bp
  • T to C, chromosome 3 at 54,807,621 bp
  • A to T, chromosome 3 at 65,946,659 bp
  • T to G, chromosome 4 at 28,963,892 bp
  • T to C, chromosome 4 at 105,000,503 bp
  • G to T, chromosome 5 at 5,036,515 bp
  • T to A, chromosome 5 at 52,843,501 bp
  • A to T, chromosome 5 at 112,355,221 bp
  • T to A, chromosome 5 at 150,541,743 bp
  • A to C, chromosome 6 at 68,542,356 bp
  • C to T, chromosome 6 at 70,435,196 bp
  • T to A, chromosome 6 at 115,463,172 bp
  • T to C, chromosome 6 at 124,062,024 bp
  • C to A, chromosome 7 at 11,756,401 bp
  • A to T, chromosome 7 at 12,671,097 bp
  • C to T, chromosome 7 at 43,979,501 bp
  • A to G, chromosome 7 at 79,915,163 bp
  • T to C, chromosome 7 at 89,510,646 bp
  • C to A, chromosome 7 at 98,135,790 bp
  • T to A, chromosome 7 at 103,451,883 bp
  • C to T, chromosome 7 at 107,624,715 bp
  • A to G, chromosome 7 at 108,346,552 bp
  • T to C, chromosome 7 at 108,893,529 bp
  • A to G, chromosome 7 at 135,697,866 bp
  • A to G, chromosome 8 at 104,425,458 bp
  • T to A, chromosome 8 at 110,813,807 bp
  • C to G, chromosome 9 at 108,611,739 bp
  • T to A, chromosome 9 at 121,443,781 bp
  • C to A, chromosome 10 at 116,322,662 bp
  • C to A, chromosome 10 at 129,035,503 bp
  • A to G, chromosome 11 at 23,343,604 bp
  • A to T, chromosome 11 at 60,740,579 bp
  • A to T, chromosome 11 at 74,435,761 bp
  • A to T, chromosome 11 at 82,981,306 bp
  • A to T, chromosome 12 at 3,866,192 bp
  • T to C, chromosome 12 at 4,880,754 bp
  • T to A, chromosome 12 at 21,295,111 bp
  • C to A, chromosome 12 at 69,316,315 bp
  • T to A, chromosome 12 at 76,282,936 bp
  • G to T, chromosome 12 at 80,637,508 bp
  • A to G, chromosome 12 at 103,424,406 bp
  • C to A, chromosome 12 at 107,916,904 bp
  • T to C, chromosome 13 at 4,511,216 bp
  • T to A, chromosome 13 at 14,247,603 bp
  • A to G, chromosome 13 at 21,180,823 bp
  • A to G, chromosome 13 at 43,425,084 bp
  • A to T, chromosome 13 at 49,592,242 bp
  • A to G, chromosome 13 at 118,387,219 bp
  • G to A, chromosome 14 at 65,641,905 bp
  • C to A, chromosome 15 at 39,857,223 bp
  • T to A, chromosome 15 at 79,716,192 bp
  • C to T, chromosome 15 at 99,425,880 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 90,810,234 bp
  • C to T, chromosome 17 at 23,460,169 bp
  • T to G, chromosome 17 at 27,886,913 bp
  • T to C, chromosome 17 at 35,510,474 bp
  • A to T, chromosome 17 at 38,335,429 bp
  • C to A, chromosome 18 at 12,751,020 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8914 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068766-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.