Strain Name:
C57BL/6J-MtgxR8928Btlr/Mmmh
Stock Number:
068772-MU
Citation ID:
RRID:MMRRC_068772-MU
Other Names:
R8928 (G1)
Major Collection:

Strain Information

Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Cdh1
Name: cadherin 1
Synonyms: uvomorulin, L-CAM, E-cadherin, UM, E-cad, Ecad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Fn1
Name: fibronectin 1
Synonyms: Fn, Fn-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14268
HGNC: HGNC:3778
Homologene: 1533
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: spectrin G, Spnb-2, non-erythrocytic, brain spectrin, Spnb2, elf1, elf3, 9930031C03Rik, beta fodrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Bmp7
Name: bone morphogenetic protein 7
Synonyms: OP1, osteogenic protein 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12162
HGNC: HGNC:1074
Homologene: 20410
Marchf4
Name: membrane associated ring-CH-type finger 4
Synonyms: March4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381270
Homologene: 66199
Fzd9
Name: frizzled class receptor 9
Synonyms: Fz9, mfz9, frizzled 9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14371
HGNC: HGNC:4047
Homologene: 2619
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Map1b
Name: microtubule-associated protein 1B
Synonyms: Mtap-5, Mtap5, LC1, Mtap1b, MAP5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Tmem63b
Name: transmembrane protein 63b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224807
Homologene: 101682
Plekhm1
Name: pleckstrin homology domain containing, family M (with RUN domain) member 1
Synonyms: B2, AP162, D330036J23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353047
Homologene: 8871
Hira
Name: histone cell cycle regulator
Synonyms: Tuple1, Gm15797, D16Ertd95e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15260
HGNC: HGNC:4916
Homologene: 48172
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 1200016K18Rik, 4632412M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: mechanistic target of rapamycin (serine/threonine kinase), Frap1, RAFT1, 2610315D21Rik, FKBP-rapamycin-associated protein FRAP, flat, RAPT1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, Phr1, C130061D10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Ptcd2
Name: pentatricopeptide repeat domain 2
Synonyms: 1190005P08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68927
VEGA: 13
Homologene: 11695
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Setx
Name: senataxin
Synonyms: Als4, A930037J23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Mbnl2
Name: muscleblind like splicing factor 2
Synonyms: 1110002M11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105559
VEGA: 14
Homologene: 76766
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: Elys, 6230412P20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 9530048I21Rik, 3010027A04Rik, 2410104C19Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Akap13
Name: A kinase anchor protein 13
Synonyms: PROTO-LB, Ht31, 1700026G02Rik, PROTO-LBC, 5730522G15Rik, AKAP-Lbc, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, MCPH5, D330028K02Rik, Aspm, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Pip5k1c
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms: PIP5KIgamma
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18717
HGNC: HGNC:8996
Homologene: 69032
Tfap4
Name: transcription factor AP4
Synonyms: bHLHc41, AP-4, D930048N17Rik, Tcfap4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 83383
VEGA: 16
Homologene: 2424
Palb2
Name: partner and localizer of BRCA2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233826
Homologene: 11652
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 3526402J09Rik, 5730590C14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Tbc1d23
Name: TBC1 domain family, member 23
Synonyms: D030022P07Rik, 4930451A13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67581
VEGA: 16
Homologene: 10126
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Cep85
Name: centrosomal protein 85
Synonyms: Ccdc21, 2410030J07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70012
Homologene: 11254
Chchd3
Name: coiled-coil-helix-coiled-coil-helix domain containing 3
Synonyms: 1700039J09Rik, Micos19, 0610041L09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66075
Homologene: 9851
Epha8
Name: Eph receptor A8
Synonyms: Eek, EphA8, Hek3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Dclk2
Name: doublecortin-like kinase 2
Synonyms: Click-II, Dcamkl2, 6330415M09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70762
Homologene: 69431
Srf
Name: serum response factor
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20807
VEGA: 17
Homologene: 31135
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Plk2
Name: polo like kinase 2
Synonyms: Snk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20620
VEGA: 13
Homologene: 21317
A630089N07Rik
Name: RIKEN cDNA A630089N07 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320586
VEGA: 16
Zfp317
Name: zinc finger protein 317
Synonyms: D230022C05Rik, KRAB9, Zfp75, Zfp67
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244713
Homologene: 36389
Tnc
Name: tenascin C
Synonyms: hexabrachion, C130033P17Rik, cytotactin, TN-C, tenascin-C, Hxb, TN
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Cabp7
Name: calcium binding protein 7
Synonyms: calneuron II
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192650
Homologene: 16364
Angptl2
Name: angiopoietin-like 2
Synonyms: Arp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26360
HGNC: HGNC:490
Homologene: 22695
Hepacam2
Name: HEPACAM family member 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101202
Homologene: 18724
Ms4a4d
Name: membrane-spanning 4-domains, subfamily A, member 4D
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66607
Homologene: 113790
Alas1
Name: aminolevulinic acid synthase 1
Synonyms: Alas-1, succinyl-CoA: glycine C-succinyl transferase, ALAS-N, 5-aminolevulinate synthase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11655
HGNC: HGNC:396
Homologene: 55478
Itfg1
Name: integrin alpha FG-GAP repeat containing 1
Synonyms: 2310047C21Rik, D8Wsu49e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71927
Homologene: 12423
Psrc1
Name: proline/serine-rich coiled-coil 1
Synonyms: DDA3, 5430413I02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56742
Homologene: 49603
Bsdc1
Name: BSD domain containing 1
Synonyms: 1110063F24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100383
Homologene: 32386
Arap1
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Synonyms: 2410002L19Rik, Centd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69710
Homologene: 12326
Ppp4r3b
Name: protein phosphatase 4 regulatory subunit 3B
Synonyms: Smek2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104570
Homologene: 68886
Dpy19l4
Name: dpy-19 like 4
Synonyms: Narg3, LOC381510
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Qrfprl
Name: pyroglutamylated RFamide peptide receptor like
Synonyms: C130060K24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243407
Homologene: 135976
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Egfem1
Name: EGF-like and EMI domain containing 1
Synonyms: 6130401L20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75740
Homologene: 135950
Mipol1
Name: mirror-image polydactyly 1
Synonyms: D12Ertd19e, 1700081O04Rik, 6030439O22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73490
Homologene: 16340
Pdlim4
Name: PDZ and LIM domain 4
Synonyms: Ril
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30794
Homologene: 2735
Pde5a
Name: phosphodiesterase 5A, cGMP-specific
Synonyms: PDE5A1, Pde5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242202
HGNC: HGNC:8784
Homologene: 842
Ccdc73
Name: coiled-coil domain containing 73
Synonyms: 2210415I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211936
Homologene: 52235
Tmem209
Name: transmembrane protein 209
Synonyms: 2700094F01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72649
Homologene: 18021
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: 4832426G23Rik, Myhs-p, Myhsp, MyHC-pn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Zscan18
Name: zinc finger and SCAN domain containing 18
Synonyms: EG232875
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232875
Homologene: 122136
Vinac1
Name: vinculin/alpha-catenin family member 1
Synonyms: Gm14025
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668894
Homologene: 86340
Nfatc1
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
Synonyms: NFATc, NFAT2, NF-ATc, 2210017P03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18018
VEGA: 18
HGNC: HGNC:7775
Homologene: 32336
Tnn
Name: tenascin N
Synonyms: Tnw, tenascin-W
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329278
Homologene: 18634
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Ciz1
Name: CDKN1A interacting zinc finger protein 1
Synonyms: 2900056O04Rik, 0610038H21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68379
Homologene: 8112
Prmt6
Name: protein arginine N-methyltransferase 6
Synonyms: Hrmt1l6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99890
Homologene: 10024
Mrps30
Name: mitochondrial ribosomal protein S30
Synonyms: 2610020A16Rik, Pdcd9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 59054
HGNC: HGNC:8769
Homologene: 9607
Spata31g1
Name: SPATA31 subfamily G member 1
Synonyms: 1700022I11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67317
Homologene: 52406
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MHC2A, Myhs-f1, Myhs-f, Myhsf1, MyHC-IIa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Ttc23l
Name: tetratricopeptide repeat domain 23-like
Synonyms: 4930401A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75777
Homologene: 44907
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Ccdc146
Name: coiled-coil domain containing 146
Synonyms: 4930528G09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75172
Homologene: 67159
Sorbs2
Name: sorbin and SH3 domain containing 2
Synonyms: 2010203O03Rik, 9430041O17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234214
Homologene: 83295
Tbc1d2b
Name: TBC1 domain family, member 2B
Synonyms: 1810061M12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67016
Homologene: 56694
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231014
Homologene: 27396
Vmn1r170
Name: vomeronasal 1 receptor 170
Synonyms: Gm5999
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546944
Homologene: 128341
Actc1
Name: actin, alpha, cardiac muscle 1
Synonyms: alphac-actin, Actc-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11464
HGNC: HGNC:143
Homologene: 68446
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
D630003M21Rik
Name: RIKEN cDNA D630003M21 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228846
Homologene: 18598
Or8k53
Name: olfactory receptor family 8 subfamily K member 53
Synonyms: Olfr1055, GA_x6K02T2Q125-47819205-47818258, MOR186-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259023
Homologene: 131140
Dsc3
Name: desmocollin 3
Synonyms: 5430426I24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13507
VEGA: 18
HGNC: HGNC:3037
Homologene: 1462
Or52h7
Name: olfactory receptor family 52 subfamily H member 7
Synonyms: MOR31-8, GA_x6K02T2PBJ9-7191524-7192471, Olfr652
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259050
Homologene: 17477
Fsd2
Name: fibronectin type III and SPRY domain containing 2
Synonyms: Spryd1, 9830160G03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244091
Homologene: 18252
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Dcaf7
Name: DDB1 and CUL4 associated factor 7
Synonyms: Wdr68, 1700012F10Rik, 2610037L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71833
Homologene: 55930
Or7a36
Name: olfactory receptor family 7 subfamily A member 36
Synonyms: GA_x6K02T2QGN0-2828447-2827518, MOR139-1, Olfr1352
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259074
Homologene: 131141
Ankfn1
Name: ankyrin-repeat and fibronectin type III domain containing 1
Synonyms: nmf9, LOC382543, mWAKE, 4932411E22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 382543
Homologene: 34996
Prex1
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms: P-REX1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277360
Homologene: 10821
Sart1
Name: squamous cell carcinoma antigen recognized by T cells 1
Synonyms: U5-110K
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20227
VEGA: 19
Homologene: 133770
Klhl35
Name: kelch-like 35
Synonyms: 2810406K13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72184
Homologene: 27849
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: Wdr96, 4930428C11Rik, 4930463G05Rik, D19Ertd652e, 4632415N18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Slc5a7
Name: solute carrier family 5 (choline transporter), member 7
Synonyms: CHT1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63993
VEGA: 17
Homologene: 32516
Stom
Name: stomatin
Synonyms: protein 7.2b, Epb7.2, stomatin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13830
HGNC: HGNC:3383
Homologene: 81681
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627479
Homologene: 129606
Prag1
Name: PEAK1 related kinase activating pseudokinase 1
Synonyms: NACK, D8Ertd82e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244418
Homologene: 18256
Xkr5
Name: X-linked Kx blood group related 5
Synonyms: 5430438H03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319581
Homologene: 52219
Gpr45
Name: G protein-coupled receptor 45
Synonyms: 9230112G11Rik, PSP24alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93690
HGNC: HGNC:4503
Homologene: 5228
Wscd2
Name: WSC domain containing 2
Synonyms: 4933413A10Rik, C530024P05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320916
Homologene: 35372
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: Nsk2, Nsk1, MDK4, Nsk3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
B3gnt7
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Synonyms: beta-3GnT7, C330001H22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227327
Homologene: 17049
Dsc1
Name: desmocollin 1
Synonyms: Dsc1a, Dsc1b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13505
VEGA: 18
HGNC: HGNC:3035
Homologene: 22761
Or5ap2
Name: olfactory receptor family 5 subfamily AP member 2
Synonyms: MOR201-2, Olfr1020, GA_x6K02T2Q125-47327964-47328917
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258573
Homologene: 45007
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: 5033413D22Rik, Gm6976, Gm29096
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Ajm1
Name: apical junction component 1
Synonyms: Gm996, LOC381353
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381353
Homologene: 19943
Or5t7
Name: olfactory receptor family 5 subfamily T member 17
Synonyms: Olfr1086, MOR179-2, GA_x6K02T2Q125-48168771-48167839
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258585
Homologene: 73975
Spon1
Name: spondin 1, (f-spondin) extracellular matrix protein
Synonyms: D330035F22Rik, FSP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233744
Homologene: 4453
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Nuak2
Name: NUAK family, SNF1-like kinase, 2
Synonyms: Snark, 1200013B22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74137
Homologene: 12539
Parp16
Name: poly (ADP-ribose) polymerase family, member 16
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214424
VEGA: 9
Homologene: 9878
Zfp456
Name: zinc finger protein 456
Synonyms: Rslcan-13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408065
Homologene: 110878
Rrp8
Name: ribosomal RNA processing 8
Synonyms: 1500003O22Rik, 2900001K19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101867
Homologene: 5621
Cdh22
Name: cadherin 22
Synonyms: PB-cadherin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104010
Homologene: 23148
Ppl
Name: periplakin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Lpcat2b
Name: lysophosphatidylcholine acyltransferase 2B
Synonyms: 4921521K07Rik, Aytl1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70902
Homologene: 86793
Ccdc113
Name: coiled-coil domain containing 113
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244608
Homologene: 40927
Vmn2r44
Name: vomeronasal 2, receptor 44
Synonyms: EG434113
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434113
Homologene: 113703
Gm15922
Name: predicted gene 15922
Type: Gene
Species: Mouse
Chromosome: 7
Fpr2
Name: formyl peptide receptor 2
Synonyms: E330010I07Rik, Fpr-rs2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14289
HGNC: HGNC:3827
Homologene: 74395
Or5k15
Name: olfactory receptor family 5 subfamily J member 15
Synonyms: MOR184-6, GA_x54KRFPKG5P-55108059-55107100, Olfr178
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258999
Homologene: 79412
Arl4d
Name: ADP-ribosylation factor-like 4D
Synonyms: Arl5, Arfl4, Arf4l, 1110036H21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80981
HGNC: HGNC:656
Homologene: 1255
Nt5c1a
Name: 5'-nucleotidase, cytosolic IA
Synonyms: LOC230718, Cn1a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230718
Homologene: 57173
Or5v1
Name: olfactory receptor family 5 subfamily V member 1
Synonyms: MOR249-2, GA_x6K02T2PSCP-1956307-1957260, Olfr110
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258325
Homologene: 73968
Vopp1
Name: vesicular, overexpressed in cancer, prosurvival protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232023
Homologene: 12772
Or10p22
Name: olfactory receptor family 10 subfamily P member 22
Synonyms: Olfr9, GA_x6K02T2PULF-10675610-10676548, MOR269-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18373
Homologene: 85121
Rbpjl
Name: recombination signal binding protein for immunoglobulin kappa J region-like
Synonyms: RBP-J kappa-like, RBP-L, Rbpsuhl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19668
Homologene: 7512
Or2i1
Name: olfactory receptor family 2 subfamily I member 1
Synonyms: Olfr94, GA_x6K02T2PSCP-1637650-1636712, MOR256-32P
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258219
HGNC: HGNC:8258
Homologene: 79123
Atp23
Name: ATP23 metallopeptidase and ATP synthase assembly factor homolog
Synonyms: 1110068E08Rik, Xrcc6bp1, 2410012H02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68876
VEGA: 10
Homologene: 41699
Lysmd1
Name: LysM, putative peptidoglycan-binding, domain containing 1
Synonyms: 2610022K04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 217779
Homologene: 41742
Or8b49
Name: olfactory receptor family 8 subfamily B member 49
Synonyms: MOR165-9P, Olfr913, GA_x6K02T2PVTD-32296575-32297513, MOR165-10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258225
VEGA: 9
Homologene: 79398
Gm5862
Name: predicted gene 5862
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545739
Homologene: 69402
Tmem200c
Name: transmembrane protein 200C
Synonyms: Gm6338
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 622645
VEGA: 17
Homologene: 78765
Ighv8-9
Name: immunoglobulin heavy variable V8-9
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432709
Tdpoz6
Name: TD and POZ domain containing 6
Synonyms: Gm37596, Gm9107
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668325
Gm45844
Name: predicted gene 45844
Type: Gene
Species: Mouse
Chromosome: 7
Rbp7
Name: retinol binding protein 7, cellular
Synonyms: 1110002J23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 63954
Homologene: 32521
H4c11
Name: H4 clustered histone 11
Synonyms: Hist1h4j
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319159
Homologene: 134474
Inafm1
Name: InaF motif containing 1
Synonyms: 2610014I16Rik, Prr24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66300
Homologene: 104918
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 43,033,154 bp
  • T to C, chromosome 1 at 71,599,376 bp
  • T to C, chromosome 1 at 71,602,618 bp
  • C to A, chromosome 1 at 72,534,876 bp
  • T to A, chromosome 1 at 86,305,117 bp
  • T to A, chromosome 1 at 132,328,178 bp
  • T to A, chromosome 1 at 135,978,246 bp
  • T to A, chromosome 1 at 139,490,387 bp
  • T to C, chromosome 1 at 160,125,529 bp
  • T to A, chromosome 1 at 172,104,170 bp
  • C to A, chromosome 1 at 179,769,061 bp
  • A to G, chromosome 2 at 25,578,565 bp
  • A to G, chromosome 2 at 29,126,959 bp
  • A to T, chromosome 2 at 32,367,500 bp
  • G to A, chromosome 2 at 33,242,304 bp
  • T to C, chromosome 2 at 35,315,925 bp
  • A to T, chromosome 2 at 85,849,574 bp
  • T to C, chromosome 2 at 86,347,746 bp
  • T to C, chromosome 2 at 86,677,286 bp
  • C to A, chromosome 2 at 104,992,197 bp
  • T to A, chromosome 2 at 114,050,400 bp
  • A to G, chromosome 2 at 129,040,869 bp
  • T to C, chromosome 2 at 158,217,527 bp
  • A to G, chromosome 2 at 164,408,393 bp
  • T to A, chromosome 2 at 165,123,584 bp
  • C to T, chromosome 2 at 166,585,075 bp
  • C to T, chromosome 2 at 172,879,418 bp
  • A to T, chromosome 2 at 180,202,039 bp
  • A to C, chromosome 3 at 29,690,412 bp
  • G to T, chromosome 3 at 86,831,741 bp
  • T to A, chromosome 3 at 93,692,643 bp
  • A to T, chromosome 3 at 95,138,520 bp
  • T to G, chromosome 3 at 108,386,657 bp
  • T to C, chromosome 3 at 110,250,932 bp
  • T to A, chromosome 3 at 122,839,600 bp
  • A to T, chromosome 4 at 11,304,674 bp
  • A to T, chromosome 4 at 42,972,251 bp
  • T to C, chromosome 4 at 58,301,638 bp
  • A to T, chromosome 4 at 64,007,358 bp
  • G to A, chromosome 4 at 113,483,902 bp
  • C to T, chromosome 4 at 123,208,488 bp
  • G to T, chromosome 4 at 128,475,789 bp
  • G to T, chromosome 4 at 129,461,646 bp
  • G to T, chromosome 4 at 134,132,404 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • T to C, chromosome 4 at 148,538,899 bp
  • A to T, chromosome 4 at 149,453,501 bp
  • T to A, chromosome 5 at 9,446,979 bp
  • T to C, chromosome 5 at 21,333,062 bp
  • T to A, chromosome 5 at 26,021,680 bp
  • G to T, chromosome 5 at 34,966,289 bp
  • G to T, chromosome 5 at 107,433,047 bp
  • T to C, chromosome 5 at 108,802,265 bp
  • A to T, chromosome 5 at 113,577,340 bp
  • T to C, chromosome 5 at 124,083,643 bp
  • A to T, chromosome 5 at 124,789,764 bp
  • A to T, chromosome 5 at 135,249,735 bp
  • C to A, chromosome 6 at 3,467,623 bp
  • C to T, chromosome 6 at 30,489,366 bp
  • T to A, chromosome 6 at 32,804,016 bp
  • A to G, chromosome 6 at 57,754,593 bp
  • C to A, chromosome 6 at 65,381,613 bp
  • A to C, chromosome 7 at 3,739,359 bp
  • A to G, chromosome 7 at 7,278,095 bp
  • A to T, chromosome 7 at 8,378,102 bp
  • G to A, chromosome 7 at 12,775,193 bp
  • G to A, chromosome 7 at 16,273,055 bp
  • A to G, chromosome 7 at 23,606,389 bp
  • T to A, chromosome 7 at 75,609,858 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCCTCCTCC, chromosome 7 at 80,512,904 bp
  • T to C, chromosome 7 at 81,559,606 bp
  • T to G, chromosome 7 at 99,471,014 bp
  • G to A, chromosome 7 at 101,408,117 bp
  • A to T, chromosome 7 at 104,565,022 bp
  • C to A, chromosome 7 at 105,734,866 bp
  • T to C, chromosome 7 at 114,030,357 bp
  • A to T, chromosome 7 at 122,124,598 bp
  • A to G, chromosome 8 at 18,933,771 bp
  • T to G, chromosome 8 at 36,147,206 bp
  • T to A, chromosome 8 at 45,795,915 bp
  • C to T, chromosome 8 at 85,840,791 bp
  • T to C, chromosome 8 at 95,540,956 bp
  • ACTCGAAATGATGTGGCTC to ACTC, chromosome 8 at 106,666,238 bp
  • C to T, chromosome 8 at 122,895,979 bp
  • T to C, chromosome 9 at 19,641,225 bp
  • A to T, chromosome 9 at 38,594,366 bp
  • A to G, chromosome 9 at 65,226,114 bp
  • C to T, chromosome 9 at 90,226,137 bp
  • T to A, chromosome 9 at 106,241,314 bp
  • T to A, chromosome 10 at 41,586,249 bp
  • A to G, chromosome 10 at 78,984,713 bp
  • T to A, chromosome 10 at 81,293,072 bp
  • A to T, chromosome 10 at 126,887,493 bp
  • T to C, chromosome 10 at 128,990,448 bp
  • T to A, chromosome 11 at 4,746,640 bp
  • T to C, chromosome 11 at 29,194,598 bp
  • C to T, chromosome 11 at 30,138,962 bp
  • T to C, chromosome 11 at 54,059,964 bp
  • A to T, chromosome 11 at 67,188,683 bp
  • G to A, chromosome 11 at 67,283,255 bp
  • G to A, chromosome 11 at 89,538,453 bp
  • A to C, chromosome 11 at 101,667,066 bp
  • A to G, chromosome 11 at 103,377,213 bp
  • A to G, chromosome 11 at 105,810,505 bp
  • A to G, chromosome 11 at 106,051,926 bp
  • T to A, chromosome 12 at 57,460,865 bp
  • T to A, chromosome 12 at 115,468,584 bp
  • T to A, chromosome 13 at 18,745,331 bp
  • T to C, chromosome 13 at 21,735,355 bp
  • G to A, chromosome 13 at 67,366,484 bp
  • G to A, chromosome 13 at 99,339,997 bp
  • C to G, chromosome 13 at 99,432,116 bp
  • T to G, chromosome 13 at 110,399,216 bp
  • A to G, chromosome 13 at 118,386,669 bp
  • T to A, chromosome 14 at 35,580,766 bp
  • T to A, chromosome 14 at 103,156,345 bp
  • A to G, chromosome 14 at 120,396,562 bp
  • T to A, chromosome 15 at 10,530,634 bp
  • T to C, chromosome 16 at 4,551,354 bp
  • T to A, chromosome 16 at 5,087,610 bp
  • A to G, chromosome 16 at 18,897,787 bp
  • A to G, chromosome 16 at 57,171,789 bp
  • T to A, chromosome 16 at 58,889,387 bp
  • T to C, chromosome 16 at 59,494,760 bp
  • A to G, chromosome 16 at 59,556,352 bp
  • A to T, chromosome 16 at 98,066,167 bp
  • T to C, chromosome 17 at 17,893,462 bp
  • T to A, chromosome 17 at 37,196,970 bp
  • A to T, chromosome 17 at 37,498,692 bp
  • C to A, chromosome 17 at 45,410,913 bp
  • A to T, chromosome 17 at 45,664,982 bp
  • T to C, chromosome 17 at 46,549,169 bp
  • G to T, chromosome 17 at 54,284,230 bp
  • A to T, chromosome 17 at 66,448,633 bp
  • A to G, chromosome 17 at 68,841,738 bp
  • A to T, chromosome 18 at 19,974,177 bp
  • G to T, chromosome 18 at 20,110,168 bp
  • A to T, chromosome 18 at 80,697,965 bp
  • T to C, chromosome 19 at 5,388,501 bp
  • A to C, chromosome 19 at 11,556,210 bp
  • T to A, chromosome 19 at 47,815,960 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8928 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068772-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.