Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8928Btlr/Mmmh
Stock Number:
068772-MU
Citation ID:
RRID:MMRRC_068772-MU
Other Names:
R8928 (G1)
Major Collection:

Strain Information

Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Cdh1
Name: cadherin 1
Synonyms: E-cadherin, Ecad, UM, uvomorulin, L-CAM, E-cad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Bmp7
Name: bone morphogenetic protein 7
Synonyms: osteogenic protein 1, OP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12162
HGNC: HGNC:1074
Homologene: 20410
Marchf4
Name: membrane associated ring-CH-type finger 4
Synonyms: March4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381270
Homologene: 66199
Fzd9
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14371
HGNC: HGNC:4047
Homologene: 2619
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 43,033,154 bp
  • T to C, chromosome 1 at 71,599,376 bp
  • T to C, chromosome 1 at 71,602,618 bp
  • C to A, chromosome 1 at 72,534,876 bp
  • T to A, chromosome 1 at 86,305,117 bp
  • T to A, chromosome 1 at 132,328,178 bp
  • T to A, chromosome 1 at 135,978,246 bp
  • T to A, chromosome 1 at 139,490,387 bp
  • T to C, chromosome 1 at 160,125,529 bp
  • T to A, chromosome 1 at 172,104,170 bp
  • C to A, chromosome 1 at 179,769,061 bp
  • A to G, chromosome 2 at 25,578,565 bp
  • A to G, chromosome 2 at 29,126,959 bp
  • A to T, chromosome 2 at 32,367,500 bp
  • G to A, chromosome 2 at 33,242,304 bp
  • T to C, chromosome 2 at 35,315,925 bp
  • A to T, chromosome 2 at 85,849,574 bp
  • T to C, chromosome 2 at 86,347,746 bp
  • T to C, chromosome 2 at 86,677,286 bp
  • C to A, chromosome 2 at 104,992,197 bp
  • T to A, chromosome 2 at 114,050,400 bp
  • A to G, chromosome 2 at 129,040,869 bp
  • T to C, chromosome 2 at 158,217,527 bp
  • A to G, chromosome 2 at 164,408,393 bp
  • T to A, chromosome 2 at 165,123,584 bp
  • C to T, chromosome 2 at 166,585,075 bp
  • C to T, chromosome 2 at 172,879,418 bp
  • A to T, chromosome 2 at 180,202,039 bp
  • A to C, chromosome 3 at 29,690,412 bp
  • G to T, chromosome 3 at 86,831,741 bp
  • T to A, chromosome 3 at 93,692,643 bp
  • A to T, chromosome 3 at 95,138,520 bp
  • T to G, chromosome 3 at 108,386,657 bp
  • T to C, chromosome 3 at 110,250,932 bp
  • T to A, chromosome 3 at 122,839,600 bp
  • A to T, chromosome 4 at 11,304,674 bp
  • A to T, chromosome 4 at 42,972,251 bp
  • T to C, chromosome 4 at 58,301,638 bp
  • A to T, chromosome 4 at 64,007,358 bp
  • G to A, chromosome 4 at 113,483,902 bp
  • C to T, chromosome 4 at 123,208,488 bp
  • G to T, chromosome 4 at 128,475,789 bp
  • G to T, chromosome 4 at 129,461,646 bp
  • G to T, chromosome 4 at 134,132,404 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • T to C, chromosome 4 at 148,538,899 bp
  • A to T, chromosome 4 at 149,453,501 bp
  • T to A, chromosome 5 at 9,446,979 bp
  • T to C, chromosome 5 at 21,333,062 bp
  • T to A, chromosome 5 at 26,021,680 bp
  • G to T, chromosome 5 at 34,966,289 bp
  • G to T, chromosome 5 at 107,433,047 bp
  • T to C, chromosome 5 at 108,802,265 bp
  • A to T, chromosome 5 at 113,577,340 bp
  • T to C, chromosome 5 at 124,083,643 bp
  • A to T, chromosome 5 at 124,789,764 bp
  • A to T, chromosome 5 at 135,249,735 bp
  • C to A, chromosome 6 at 3,467,623 bp
  • C to T, chromosome 6 at 30,489,366 bp
  • T to A, chromosome 6 at 32,804,016 bp
  • A to G, chromosome 6 at 57,754,593 bp
  • C to A, chromosome 6 at 65,381,613 bp
  • A to C, chromosome 7 at 3,739,359 bp
  • A to G, chromosome 7 at 7,278,095 bp
  • A to T, chromosome 7 at 8,378,102 bp
  • G to A, chromosome 7 at 12,775,193 bp
  • G to A, chromosome 7 at 16,273,055 bp
  • A to G, chromosome 7 at 23,606,389 bp
  • T to A, chromosome 7 at 75,609,858 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCCTCCTCC, chromosome 7 at 80,512,904 bp
  • T to C, chromosome 7 at 81,559,606 bp
  • T to G, chromosome 7 at 99,471,014 bp
  • G to A, chromosome 7 at 101,408,117 bp
  • A to T, chromosome 7 at 104,565,022 bp
  • C to A, chromosome 7 at 105,734,866 bp
  • T to C, chromosome 7 at 114,030,357 bp
  • A to T, chromosome 7 at 122,124,598 bp
  • A to G, chromosome 8 at 18,933,771 bp
  • T to G, chromosome 8 at 36,147,206 bp
  • T to A, chromosome 8 at 45,795,915 bp
  • C to T, chromosome 8 at 85,840,791 bp
  • T to C, chromosome 8 at 95,540,956 bp
  • ACTCGAAATGATGTGGCTC to ACTC, chromosome 8 at 106,666,238 bp
  • C to T, chromosome 8 at 122,895,979 bp
  • T to C, chromosome 9 at 19,641,225 bp
  • A to T, chromosome 9 at 38,594,366 bp
  • A to G, chromosome 9 at 65,226,114 bp
  • C to T, chromosome 9 at 90,226,137 bp
  • T to A, chromosome 9 at 106,241,314 bp
  • T to A, chromosome 10 at 41,586,249 bp
  • A to G, chromosome 10 at 78,984,713 bp
  • T to A, chromosome 10 at 81,293,072 bp
  • A to T, chromosome 10 at 126,887,493 bp
  • T to C, chromosome 10 at 128,990,448 bp
  • T to A, chromosome 11 at 4,746,640 bp
  • T to C, chromosome 11 at 29,194,598 bp
  • C to T, chromosome 11 at 30,138,962 bp
  • T to C, chromosome 11 at 54,059,964 bp
  • A to T, chromosome 11 at 67,188,683 bp
  • G to A, chromosome 11 at 67,283,255 bp
  • G to A, chromosome 11 at 89,538,453 bp
  • A to C, chromosome 11 at 101,667,066 bp
  • A to G, chromosome 11 at 103,377,213 bp
  • A to G, chromosome 11 at 105,810,505 bp
  • A to G, chromosome 11 at 106,051,926 bp
  • T to A, chromosome 12 at 57,460,865 bp
  • T to A, chromosome 12 at 115,468,584 bp
  • T to A, chromosome 13 at 18,745,331 bp
  • T to C, chromosome 13 at 21,735,355 bp
  • G to A, chromosome 13 at 67,366,484 bp
  • G to A, chromosome 13 at 99,339,997 bp
  • C to G, chromosome 13 at 99,432,116 bp
  • T to G, chromosome 13 at 110,399,216 bp
  • A to G, chromosome 13 at 118,386,669 bp
  • T to A, chromosome 14 at 35,580,766 bp
  • T to A, chromosome 14 at 103,156,345 bp
  • A to G, chromosome 14 at 120,396,562 bp
  • T to A, chromosome 15 at 10,530,634 bp
  • T to C, chromosome 16 at 4,551,354 bp
  • T to A, chromosome 16 at 5,087,610 bp
  • A to G, chromosome 16 at 18,897,787 bp
  • A to G, chromosome 16 at 57,171,789 bp
  • T to A, chromosome 16 at 58,889,387 bp
  • T to C, chromosome 16 at 59,494,760 bp
  • A to G, chromosome 16 at 59,556,352 bp
  • A to T, chromosome 16 at 98,066,167 bp
  • T to C, chromosome 17 at 17,893,462 bp
  • T to A, chromosome 17 at 37,196,970 bp
  • A to T, chromosome 17 at 37,498,692 bp
  • C to A, chromosome 17 at 45,410,913 bp
  • A to T, chromosome 17 at 45,664,982 bp
  • T to C, chromosome 17 at 46,549,169 bp
  • G to T, chromosome 17 at 54,284,230 bp
  • A to T, chromosome 17 at 66,448,633 bp
  • A to G, chromosome 17 at 68,841,738 bp
  • A to T, chromosome 18 at 19,974,177 bp
  • G to T, chromosome 18 at 20,110,168 bp
  • A to T, chromosome 18 at 80,697,965 bp
  • T to C, chromosome 19 at 5,388,501 bp
  • A to C, chromosome 19 at 11,556,210 bp
  • T to A, chromosome 19 at 47,815,960 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8928 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068772-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.