Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8943Btlr/Mmmh
Stock Number:
068782-MU
Citation ID:
RRID:MMRRC_068782-MU
Other Names:
R8943 (G1)
Major Collection:

Strain Information

Cadm1
Name: cell adhesion molecule 1
Synonyms: 3100001I08Rik, 2900073G06Rik, RA175N, RA175C, RA175B, RA175A, Necl2, SgIGSF, Tslc1, SynCam, Igsf4, Igsf4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54725
HGNC: HGNC:5951
Homologene: 8641
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Mthfd1l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: 2410004L15Rik, Fthfsdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270685
Homologene: 56706
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Sfswap
Name: splicing factor SWAP
Synonyms: 6330437E22Rik, 1190005N23Rik, Sfrs8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231769
Homologene: 134548
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
2610021A01Rik
Name: RIKEN cDNA 2610021A01 gene
Type: Gene
Species: Mouse
Chromosome: 7
Actr1a
Name: ARP1 actin-related protein 1A, centractin alpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54130
VEGA: 19
HGNC: HGNC:167
Homologene: 21173
Mc4r
Name: melanocortin 4 receptor
Synonyms: Fatboy, Pkcp
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17202
VEGA: 18
HGNC: HGNC:6932
Homologene: 4320
Ipo8
Name: importin 8
Synonyms: OM-1, 6230418K12Rik, Om1, C130009K11Rik, Ranbp8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320727
HGNC: HGNC:9853
Homologene: 48430
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Lpcat1
Name: lysophosphatidylcholine acyltransferase 1
Synonyms: 2900035H07Rik, LPCAT, Aytl2, rd11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210992
Homologene: 9871
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Fndc3b
Name: fibronectin type III domain containing 3B
Synonyms: 1600019O04Rik, fad104
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72007
Homologene: 11244
Fam193a
Name: family with sequence homology 193, member A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231128
Homologene: 2746
Rbm15
Name: RNA binding motif protein 15
Synonyms: C230088J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229700
Homologene: 23383
Pdcd1lg2
Name: programmed cell death 1 ligand 2
Synonyms: B7-DC, PD-L2, Btdc, F730015O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58205
Homologene: 10973
Aak1
Name: AP2 associated kinase 1
Synonyms: 5530400K14Rik, D6Ertd245e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269774
Homologene: 128746
Eif2b3
Name: eukaryotic translation initiation factor 2B, subunit 3
Synonyms: 1190002P15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108067
HGNC: HGNC:3259
Homologene: 7005
Trappc6b
Name: trafficking protein particle complex 6B
Synonyms: 5830498C14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78232
VEGA: 12
Homologene: 42466
Lrch1
Name: leucine-rich repeats and calponin homology (CH) domain containing 1
Synonyms: 4832412D13Rik, Chdc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380916
VEGA: 14
Homologene: 32244
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229473
Homologene: 9057
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Sohlh2
Name: spermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms: 4933406N12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74434
Homologene: 9864
Aldh1a2
Name: aldehyde dehydrogenase family 1, subfamily A2
Synonyms: Aldh1a7, Raldh2, retinaldehyde dehydrogenase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19378
Homologene: 68368
Pigg
Name: phosphatidylinositol glycan anchor biosynthesis, class G
Synonyms: Gpi7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433931
Homologene: 39421
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Vmn1r33
Name: vomeronasal 1 receptor 33
Synonyms: V1rc14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171187
Homologene: 110800
Cfap53
Name: cilia and flagella associated protein 53
Synonyms: 4933415I03Rik, Ccdc11
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74453
Homologene: 27056
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Cct6b
Name: chaperonin containing TCP1 subunit 6B
Synonyms: CCTzeta-2, Cctz-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12467
HGNC: HGNC:1621
Homologene: 55978
Krt71
Name: keratin 71
Synonyms: mK6irs, Cu, mK6irs1, Ca, Krt2-6g, Cal4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56735
Homologene: 88864
Arhgef10l
Name: Rho guanine nucleotide exchange factor 10-like
Synonyms: 2810441C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72754
Homologene: 10017
Dgkb
Name: diacylglycerol kinase, beta
Synonyms: DGK-beta, C630029D13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217480
VEGA: 12
HGNC: HGNC:2850
Homologene: 37875
Ppfibp1
Name: PTPRF interacting protein, binding protein 1 (liprin beta 1)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67533
HGNC: HGNC:9249
Homologene: 2685
Zup1
Name: zinc finger containing ubiquitin peptidase 1
Synonyms: 2700019D07Rik, Zufsp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72580
VEGA: 10
Homologene: 12472
Foxe3
Name: forkhead box E3
Synonyms: FREAC8, rct
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30923
HGNC: HGNC:3808
Homologene: 32145
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Sstr4
Name: somatostatin receptor 4
Synonyms: sst4, Smstr4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20608
Homologene: 20286
Krt75
Name: keratin 75
Synonyms: Krt2-6hf, 4732468K03Rik, Krtcap1, K6hf
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109052
Homologene: 20983
Dpysl5
Name: dihydropyrimidinase-like 5
Synonyms: Crmp5, CRMP-5, CRAM
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 65254
Homologene: 41347
Zfp446
Name: zinc finger protein 446
Synonyms: A630035I11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269870
Homologene: 9910
Ak5
Name: adenylate kinase 5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229949
HGNC: HGNC:365
Homologene: 76103
Vmn1r229
Name: vomeronasal 1 receptor 229
Synonyms: V1re1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171224
Homologene: 74319
Pira12
Name: paired-Ig-like receptor A12
Synonyms: Gm14548
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100038909
Homologene: 134028
Capn10
Name: calpain 10
Synonyms: Capn8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23830
HGNC: HGNC:1477
Homologene: 36323
Or5d38
Name: olfactory receptor family 5 subfamily D member 38
Synonyms: GA_x6K02T2Q125-49616865-49615915, MOR174-6, Olfr1166
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258644
Homologene: 138307
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
BC061237
Name: cDNA sequence BC061237
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 385138
Homologene: 128452
Gm5591
Name: predicted gene 5591
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434171
Homologene: 80005
Rhbdl1
Name: rhomboid like 1
Synonyms: Rhbdl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214951
Homologene: 2946
Atoh7
Name: atonal bHLH transcription factor 7
Synonyms: Math5, bHLHa13
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 53404
VEGA: 10
Homologene: 32338
Gm7995
Name: predicted gene 7995
Synonyms: Gm3586
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666233
Homologene: 115686
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 92,943,732 bp
  • A to T, chromosome 2 at 66,694,862 bp
  • T to A, chromosome 2 at 88,124,374 bp
  • T to C, chromosome 2 at 112,635,324 bp
  • T to A, chromosome 2 at 148,395,862 bp
  • T to C, chromosome 3 at 27,501,180 bp
  • C to A, chromosome 3 at 55,196,861 bp
  • A to T, chromosome 3 at 83,924,172 bp
  • T to A, chromosome 3 at 107,332,056 bp
  • T to A, chromosome 3 at 148,828,483 bp
  • A to G, chromosome 3 at 152,655,874 bp
  • C to A, chromosome 4 at 114,925,326 bp
  • G to A, chromosome 4 at 117,044,581 bp
  • A to G, chromosome 4 at 140,565,239 bp
  • G to T, chromosome 5 at 30,778,031 bp
  • A to G, chromosome 5 at 34,440,452 bp
  • T to C, chromosome 5 at 101,845,365 bp
  • G to A, chromosome 5 at 108,336,200 bp
  • A to G, chromosome 5 at 129,504,104 bp
  • T to A, chromosome 6 at 66,611,799 bp
  • A to G, chromosome 6 at 86,987,252 bp
  • T to A, chromosome 6 at 147,019,183 bp
  • G to A, chromosome 6 at 148,775,049 bp
  • T to C, chromosome 7 at 3,895,366 bp
  • C to T, chromosome 7 at 12,979,637 bp
  • A to T, chromosome 7 at 38,520,303 bp
  • T to C, chromosome 7 at 41,626,243 bp
  • T to C, chromosome 7 at 126,412,158 bp
  • A to G, chromosome 7 at 131,119,643 bp
  • T to C, chromosome 9 at 47,789,838 bp
  • T to C, chromosome 9 at 71,261,773 bp
  • T to C, chromosome 9 at 99,696,109 bp
  • A to T, chromosome 10 at 4,028,466 bp
  • A to G, chromosome 10 at 33,919,305 bp
  • A to G, chromosome 10 at 63,100,159 bp
  • T to C, chromosome 11 at 34,708,819 bp
  • T to C, chromosome 11 at 36,944,034 bp
  • C to T, chromosome 11 at 80,095,698 bp
  • T to C, chromosome 11 at 82,764,133 bp
  • A to T, chromosome 11 at 83,346,753 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • T to A, chromosome 12 at 38,602,778 bp
  • A to G, chromosome 12 at 59,050,363 bp
  • A to G, chromosome 13 at 73,513,910 bp
  • A to T, chromosome 14 at 42,310,271 bp
  • A to G, chromosome 14 at 44,504,201 bp
  • A to T, chromosome 14 at 74,795,368 bp
  • A to T, chromosome 15 at 101,568,332 bp
  • A to G, chromosome 15 at 101,736,745 bp
  • A to T, chromosome 17 at 20,815,156 bp
  • A to T, chromosome 17 at 25,835,142 bp
  • A to G, chromosome 17 at 52,797,458 bp
  • A to C, chromosome 18 at 66,860,039 bp
  • A to G, chromosome 18 at 74,299,182 bp
  • T to C, chromosome 19 at 29,446,153 bp
  • C to A, chromosome 19 at 46,380,999 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8943 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068782-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.