Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8955Btlr/Mmmh
Stock Number:
068791-MU
Citation ID:
RRID:MMRRC_068791-MU
Other Names:
R8955 (G1)
Major Collection:

Strain Information

Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Gsr
Name: glutathione reductase
Synonyms: Gr-1, Gr1, D8Ertd238e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14782
HGNC: HGNC:4623
Homologene: 531
Kcnmb4
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms: Slowpoke beta 4, 2900045G12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58802
HGNC: HGNC:6289
Homologene: 8721
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 4,889,509 bp
  • A to T, chromosome 1 at 10,199,837 bp
  • T to A, chromosome 1 at 54,423,563 bp
  • T to C, chromosome 1 at 75,503,849 bp
  • T to A, chromosome 1 at 118,855,457 bp
  • T to C, chromosome 1 at 119,642,562 bp
  • T to A, chromosome 2 at 102,853,018 bp
  • T to C, chromosome 2 at 127,363,584 bp
  • T to C, chromosome 2 at 150,753,085 bp
  • T to C, chromosome 2 at 155,666,251 bp
  • C to G, chromosome 2 at 156,522,003 bp
  • C to A, chromosome 2 at 158,437,344 bp
  • C to G, chromosome 2 at 158,495,469 bp
  • T to A, chromosome 3 at 30,679,118 bp
  • A to T, chromosome 3 at 38,983,629 bp
  • G to T, chromosome 3 at 64,261,382 bp
  • T to C, chromosome 3 at 97,666,627 bp
  • C to T, chromosome 3 at 123,374,044 bp
  • T to A, chromosome 4 at 3,834,617 bp
  • A to G, chromosome 4 at 11,290,195 bp
  • C to T, chromosome 4 at 85,067,873 bp
  • T to C, chromosome 4 at 154,992,566 bp
  • T to A, chromosome 5 at 49,961,389 bp
  • T to A, chromosome 5 at 107,620,495 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • T to A, chromosome 5 at 134,216,754 bp
  • T to C, chromosome 5 at 137,331,008 bp
  • G to T, chromosome 6 at 58,307,299 bp
  • G to A, chromosome 6 at 122,966,520 bp
  • A to T, chromosome 6 at 145,171,664 bp
  • T to C, chromosome 7 at 12,925,513 bp
  • A to T, chromosome 7 at 28,546,203 bp
  • A to T, chromosome 7 at 41,400,147 bp
  • A to G, chromosome 7 at 66,269,825 bp
  • T to A, chromosome 7 at 108,630,299 bp
  • T to C, chromosome 8 at 10,376,175 bp
  • C to T, chromosome 8 at 11,758,451 bp
  • T to G, chromosome 8 at 33,693,908 bp
  • T to A, chromosome 8 at 34,817,308 bp
  • T to A, chromosome 8 at 45,308,527 bp
  • T to A, chromosome 8 at 53,521,129 bp
  • T to A, chromosome 8 at 60,501,356 bp
  • T to C, chromosome 8 at 67,963,809 bp
  • C to T, chromosome 8 at 70,721,896 bp
  • T to A, chromosome 8 at 85,231,284 bp
  • C to A, chromosome 8 at 91,280,828 bp
  • T to C, chromosome 8 at 92,678,412 bp
  • T to C, chromosome 9 at 34,944,442 bp
  • T to C, chromosome 9 at 73,038,701 bp
  • A to T, chromosome 9 at 75,898,553 bp
  • T to A, chromosome 9 at 109,338,789 bp
  • A to G, chromosome 10 at 19,759,412 bp
  • T to A, chromosome 10 at 24,669,028 bp
  • G to A, chromosome 10 at 39,948,076 bp
  • A to T, chromosome 10 at 61,757,831 bp
  • G to T, chromosome 10 at 78,847,742 bp
  • T to A, chromosome 10 at 116,473,476 bp
  • T to C, chromosome 11 at 35,698,380 bp
  • A to T, chromosome 11 at 58,890,120 bp
  • T to A, chromosome 11 at 78,254,937 bp
  • A to G, chromosome 11 at 98,753,623 bp
  • A to T, chromosome 11 at 108,752,434 bp
  • C to A, chromosome 11 at 115,440,712 bp
  • G to T, chromosome 12 at 111,682,822 bp
  • A to G, chromosome 12 at 112,610,564 bp
  • G to A, chromosome 13 at 55,596,962 bp
  • T to G, chromosome 14 at 7,892,874 bp
  • T to A, chromosome 14 at 7,904,688 bp
  • C to T, chromosome 14 at 15,358,159 bp
  • A to T, chromosome 14 at 31,285,993 bp
  • C to T, chromosome 14 at 55,496,077 bp
  • G to A, chromosome 14 at 66,142,232 bp
  • T to C, chromosome 14 at 72,556,970 bp
  • C to T, chromosome 15 at 38,029,581 bp
  • C to A, chromosome 15 at 39,097,551 bp
  • C to T, chromosome 15 at 64,704,705 bp
  • C to T, chromosome 15 at 71,462,214 bp
  • A to G, chromosome 15 at 96,420,490 bp
  • C to T, chromosome 15 at 97,016,781 bp
  • T to C, chromosome 16 at 3,990,247 bp
  • G to A, chromosome 16 at 26,482,520 bp
  • G to A, chromosome 16 at 58,450,762 bp
  • G to T, chromosome 17 at 20,688,025 bp
  • C to A, chromosome 17 at 35,661,649 bp
  • A to G, chromosome 18 at 34,268,317 bp
  • T to A, chromosome 19 at 12,901,214 bp
  • A to C, chromosome 19 at 33,473,130 bp
  • T to C, chromosome 19 at 58,799,626 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8955 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068791-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.