Strain Name:
C57BL/6J-MtgxR8955Btlr/Mmmh
Stock Number:
068791-MU
Citation ID:
RRID:MMRRC_068791-MU
Other Names:
R8955 (G1)
Major Collection:

Strain Information

Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Gsr
Name: glutathione reductase
Synonyms: Gr-1, Gr1, D8Ertd238e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14782
HGNC: HGNC:4623
Homologene: 531
Kcnmb4
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms: Slowpoke beta 4, 2900045G12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58802
HGNC: HGNC:6289
Homologene: 8721
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Hspa12a
Name: heat shock protein 12A
Synonyms: Hspa12a, 1700063D12Rik, Gm19925
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73442
VEGA: 19
Homologene: 18422
Sdf2
Name: stromal cell derived factor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20316
Homologene: 5045
Epb41l5
Name: erythrocyte membrane protein band 4.1 like 5
Synonyms: NBL5, 1700030C16Rik, E230025E14Rik, Lulu1, Epb4.1l5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226352
Homologene: 32492
Flnb
Name: filamin, beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 286940
HGNC: HGNC:3755
Homologene: 37480
Trpc4ap
Name: transient receptor potential cation channel, subfamily C, member 4 associated protein
Synonyms: Trp4-associated protein TAP1, Trrp4ap, D2Ertd113e, 4833429F06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56407
Homologene: 9224
Ralgapb
Name: Ral GTPase activating protein, beta subunit (non-catalytic)
Synonyms: B230339M05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228850
Homologene: 10666
Arfgef1
Name: ADP ribosylation factor guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Fndc3a
Name: fibronectin type III domain containing 3A
Synonyms: 1700094E19Rik, F730017H24Rik, D14Ertd453e, Fndc3, sys
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319448
Homologene: 8952
Gtf3c3
Name: general transcription factor IIIC, polypeptide 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98488
HGNC: HGNC:4666
Homologene: 40805
Prkab2
Name: protein kinase, AMP-activated, beta 2 non-catalytic subunit
Synonyms: 5730553K21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 108097
HGNC: HGNC:9379
Homologene: 38046
Chrna2
Name: cholinergic receptor nicotinic alpha 2 subunit
Synonyms: Acra-2, Acra2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110902
HGNC: HGNC:1956
Homologene: 20193
Tcea1
Name: transcription elongation factor A (SII) 1
Synonyms: S-II
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21399
Homologene: 55984
Thra
Name: thyroid hormone receptor alpha
Synonyms: T3Ralpha, T3R[a], Nr1a1, TR alpha 1, c-erbAalpha, Erba, TR alpha 2, 6430529J03Rik, Rvr, Thra2, Thra1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21833
Homologene: 37747
Adgra3
Name: adhesion G protein-coupled receptor A3
Synonyms: 3830613O22Rik, Tem5-like, Gpr125
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70693
Homologene: 19235
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: Neph2, 1500010O20Rik, 2900036G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67703
Homologene: 57050
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Rps5
Name: ribosomal protein S5
Synonyms: S5 ribosomal protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20103
Homologene: 783
Slc12a9
Name: solute carrier family 12 (potassium/chloride transporters), member 9
Synonyms: CIP1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83704
Homologene: 5429
Dusp4
Name: dual specificity phosphatase 4
Synonyms: E130306H24Rik, 2700078F24Rik, MKP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319520
HGNC: HGNC:3070
Homologene: 1065
Trmt61a
Name: tRNA methyltransferase 61A
Synonyms: 6720458F09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328162
VEGA: 12
Homologene: 6229
Dpy19l4
Name: dpy-19 like 4
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Enpp1
Name: ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms: PC-1, NPP1, Npps, Pca-1, Pca, Ly-41, Pdnp1, twy, CD203c, E-NPP1, 4833416E15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18605
HGNC: HGNC:3356
Homologene: 38151
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Macroh2a2
Name: macroH2A.2 histone
Synonyms: H2afy2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 404634
Homologene: 10246
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, 1700047E16Rik, fantom, Nphp8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Myo16
Name: myosin XVI
Synonyms: C230040D10Rik, Nyap3, BM140241
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244281
Homologene: 34710
Il20ra
Name: interleukin 20 receptor, alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237313
VEGA: 10
HGNC: HGNC:6003
Homologene: 8685
Vmn2r57
Name: vomeronasal 2, receptor 57
Synonyms: EG269902
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269902
Homologene: 104832
Fam135b
Name: family with sequence similarity 135, member B
Synonyms: A830008O07Rik, 1700010C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70363
VEGA: 15
Homologene: 66605
Slc38a4
Name: solute carrier family 38, member 4
Synonyms: Ata3, 1700012A18Rik, 1110012E16Rik, SNAT4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69354
VEGA: 15
Homologene: 75077
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Or7c19
Name: olfactory receptor family 7 subfamily C member 19
Synonyms: GA_x6K02T2NUPS-13298842-13299780, MOR141-3, Olfr371
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 258858
Homologene: 65998
Trim80
Name: tripartite motif-containing 80
Synonyms: 4933422H20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432613
Homologene: 46325
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Carmil3
Name: capping protein regulator and myosin 1 linker 3
Synonyms: Lrrc16b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268747
VEGA: 14
Homologene: 74564
Fbxw28
Name: F-box and WD-40 domain protein 28
Synonyms: Gm9337
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 668758
Homologene: 110776
Slx4
Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms: D16Bwg1016e, Btbd12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52864
Homologene: 23770
Clec4a3
Name: C-type lectin domain family 4, member a3
Synonyms: 3110037K17Rik, mDcir3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73149
Homologene: 9413
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Or5p80
Name: olfactory receptor family 5 subfamily P member 80
Synonyms: GA_x6K02T2PBJ9-10959726-10960658, MOR204-6, Olfr508
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258769
Homologene: 72039
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Entpd6
Name: ectonucleoside triphosphate diphosphohydrolase 6
Synonyms: NTPDase-6, Cd39l2, 2700026H11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12497
HGNC: HGNC:3368
Homologene: 68170
Rpap2
Name: RNA polymerase II associated protein 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231571
Homologene: 11733
Gtf2ird2
Name: GTF2I repeat domain containing 2
Synonyms: 1700012P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114674
Homologene: 24941
Vars2
Name: valyl-tRNA synthetase 2, mitochondrial
Synonyms: 1190004I24Rik, Vars2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68915
Homologene: 57502
Adra2b
Name: adrenergic receptor, alpha 2b
Synonyms: [a]2B, alpha2B, Adra-2b, a2b-AR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11552
HGNC: HGNC:282
Homologene: 553
Slc25a32
Name: solute carrier family 25, member 32
Synonyms: 2610043O12Rik, Mftc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69906
VEGA: 15
Homologene: 6151
Nccrp1
Name: non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Synonyms: LOC233038, 1190020J12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233038
Homologene: 19257
Lrrk1
Name: leucine-rich repeat kinase 1
Synonyms: D130026O16Rik, C230002E15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233328
Homologene: 23464
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Mettl14
Name: methyltransferase 14, N6-adenosine-methyltransferase subunit
Synonyms: G430022H21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 210529
Homologene: 10865
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, SRRP129, CASP11, SIP1, 2610510E10Rik, Sfrs2ip, Srsf2ip
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
Dcbld2
Name: discoidin, CUB and LCCL domain containing 2
Synonyms: 1700055P21Rik, Esdn, CLCP1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73379
Homologene: 12499
Irag2
Name: inositol 1,4,5-triphosphate receptor associated 2
Synonyms: Jaw1, D6Int7, D6Int8, D6Int5, D6Int4, D6Int3, Lrmp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Vmn1r226
Name: vomeronasal 1 receptor 226
Synonyms: V1re2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171225
Homologene: 74362
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98733
Lrrc31
Name: leucine rich repeat containing 31
Synonyms: E230002P03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320352
Irx6
Name: Iroquois homeobox 6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64379
Homologene: 41481
Or5b97
Name: olfactory receptor family 5 subfamily B member 97
Synonyms: GA_x6K02T2RE5P-3231251-3230331, MOR202-3, Olfr1447
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258698
HGNC: HGNC:8324
Homologene: 74233
Mfsd4b3-ps
Name: major facilitator superfamily domain containing 4B3, pseudogene
Synonyms: G630090E17Rik, Mfsd4b3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041085
Homologene: 136347
Lrrc3b
Name: leucine rich repeat containing 3B
Synonyms: LRP15
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218763
VEGA: 14
Homologene: 14190
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Inf2
Name: inverted formin, FH2 and WH2 domain containing
Synonyms: EG629699, 2610204M08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70435
VEGA: 12
Homologene: 82406
Vmn1r29
Name: vomeronasal 1 receptor 29
Synonyms: V1rc2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113859
Homologene: 123821
Zfp39
Name: zinc finger protein 39
Synonyms: CTfin33, Zfp-39
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22698
Homologene: 69102
Cd44
Name: CD44 antigen
Synonyms: Ly-24, Pgp-1, HERMES
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12505
HGNC: HGNC:1681
Homologene: 508
Gm10283
Name: predicted gene 10283
Synonyms: EG330776
Type: Gene
Species: Mouse
Chromosome: 8
Cep112
Name: centrosomal protein 112
Synonyms: 1700001M19Rik, 1700029K01Rik, 8430407H02Rik, Macoco, Ccdc46
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76380
Homologene: 44915
Cyp4v3
Name: cytochrome P450, family 4, subfamily v, polypeptide 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102294
Homologene: 133054
Bmp5
Name: bone morphogenetic protein 5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12160
HGNC: HGNC:1072
Homologene: 22412
Lipo5
Name: lipase, member O5
Synonyms: Gm8975
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668095
Cldn16
Name: claudin 16
Synonyms: PCLN1, claudin-16, paracellin-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114141
HGNC: HGNC:2037
Homologene: 4799
Aga
Name: aspartylglucosaminidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11593
HGNC: HGNC:318
Homologene: 13
Or7c70
Name: olfactory receptor family 7 subfamily C member 70
Synonyms: GA_x6K02T2QGN0-2962025-2962987, MOR142-2_p, MOR142-1, Olfr1356
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258305
Homologene: 71958
Tmed9
Name: transmembrane p24 trafficking protein 9
Synonyms: 2400003B06Rik, p24alpha2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67511
VEGA: 13
Homologene: 68707
Pigb
Name: phosphatidylinositol glycan anchor biosynthesis, class B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 55981
HGNC: HGNC:8959
Homologene: 3570
Rps20
Name: ribosomal protein S20
Synonyms: 4632426K06Rik, Dsk4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67427
Homologene: 37417
Gm3336
Name: predicted gene 3336
Synonyms: 2410018E23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502950
Homologene: 136417
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 4,889,509 bp
  • A to T, chromosome 1 at 10,199,837 bp
  • T to A, chromosome 1 at 54,423,563 bp
  • T to C, chromosome 1 at 75,503,849 bp
  • T to A, chromosome 1 at 118,855,457 bp
  • T to C, chromosome 1 at 119,642,562 bp
  • T to A, chromosome 2 at 102,853,018 bp
  • T to C, chromosome 2 at 127,363,584 bp
  • T to C, chromosome 2 at 150,753,085 bp
  • T to C, chromosome 2 at 155,666,251 bp
  • C to G, chromosome 2 at 156,522,003 bp
  • C to A, chromosome 2 at 158,437,344 bp
  • C to G, chromosome 2 at 158,495,469 bp
  • T to A, chromosome 3 at 30,679,118 bp
  • A to T, chromosome 3 at 38,983,629 bp
  • G to T, chromosome 3 at 64,261,382 bp
  • T to C, chromosome 3 at 97,666,627 bp
  • C to T, chromosome 3 at 123,374,044 bp
  • T to A, chromosome 4 at 3,834,617 bp
  • A to G, chromosome 4 at 11,290,195 bp
  • C to T, chromosome 4 at 85,067,873 bp
  • T to C, chromosome 4 at 154,992,566 bp
  • T to A, chromosome 5 at 49,961,389 bp
  • T to A, chromosome 5 at 107,620,495 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • T to A, chromosome 5 at 134,216,754 bp
  • T to C, chromosome 5 at 137,331,008 bp
  • G to T, chromosome 6 at 58,307,299 bp
  • G to A, chromosome 6 at 122,966,520 bp
  • A to T, chromosome 6 at 145,171,664 bp
  • T to C, chromosome 7 at 12,925,513 bp
  • A to T, chromosome 7 at 28,546,203 bp
  • A to T, chromosome 7 at 41,400,147 bp
  • A to G, chromosome 7 at 66,269,825 bp
  • T to A, chromosome 7 at 108,630,299 bp
  • T to C, chromosome 8 at 10,376,175 bp
  • C to T, chromosome 8 at 11,758,451 bp
  • T to G, chromosome 8 at 33,693,908 bp
  • T to A, chromosome 8 at 34,817,308 bp
  • T to A, chromosome 8 at 45,308,527 bp
  • T to A, chromosome 8 at 53,521,129 bp
  • T to A, chromosome 8 at 60,501,356 bp
  • T to C, chromosome 8 at 67,963,809 bp
  • C to T, chromosome 8 at 70,721,896 bp
  • T to A, chromosome 8 at 85,231,284 bp
  • C to A, chromosome 8 at 91,280,828 bp
  • T to C, chromosome 8 at 92,678,412 bp
  • T to C, chromosome 9 at 34,944,442 bp
  • T to C, chromosome 9 at 73,038,701 bp
  • A to T, chromosome 9 at 75,898,553 bp
  • T to A, chromosome 9 at 109,338,789 bp
  • A to G, chromosome 10 at 19,759,412 bp
  • T to A, chromosome 10 at 24,669,028 bp
  • G to A, chromosome 10 at 39,948,076 bp
  • A to T, chromosome 10 at 61,757,831 bp
  • G to T, chromosome 10 at 78,847,742 bp
  • T to A, chromosome 10 at 116,473,476 bp
  • T to C, chromosome 11 at 35,698,380 bp
  • A to T, chromosome 11 at 58,890,120 bp
  • T to A, chromosome 11 at 78,254,937 bp
  • A to G, chromosome 11 at 98,753,623 bp
  • A to T, chromosome 11 at 108,752,434 bp
  • C to A, chromosome 11 at 115,440,712 bp
  • G to T, chromosome 12 at 111,682,822 bp
  • A to G, chromosome 12 at 112,610,564 bp
  • G to A, chromosome 13 at 55,596,962 bp
  • T to G, chromosome 14 at 7,892,874 bp
  • T to A, chromosome 14 at 7,904,688 bp
  • C to T, chromosome 14 at 15,358,159 bp
  • A to T, chromosome 14 at 31,285,993 bp
  • C to T, chromosome 14 at 55,496,077 bp
  • G to A, chromosome 14 at 66,142,232 bp
  • T to C, chromosome 14 at 72,556,970 bp
  • C to T, chromosome 15 at 38,029,581 bp
  • C to A, chromosome 15 at 39,097,551 bp
  • C to T, chromosome 15 at 64,704,705 bp
  • C to T, chromosome 15 at 71,462,214 bp
  • A to G, chromosome 15 at 96,420,490 bp
  • C to T, chromosome 15 at 97,016,781 bp
  • T to C, chromosome 16 at 3,990,247 bp
  • G to A, chromosome 16 at 26,482,520 bp
  • G to A, chromosome 16 at 58,450,762 bp
  • G to T, chromosome 17 at 20,688,025 bp
  • C to A, chromosome 17 at 35,661,649 bp
  • A to G, chromosome 18 at 34,268,317 bp
  • T to A, chromosome 19 at 12,901,214 bp
  • A to C, chromosome 19 at 33,473,130 bp
  • T to C, chromosome 19 at 58,799,626 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8955 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068791-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.