Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8956Btlr/Mmmh
Stock Number:
068792-MU
Citation ID:
RRID:MMRRC_068792-MU
Other Names:
R8956 (G1)
Major Collection:

Strain Information

B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Cdk4
Name: cyclin dependent kinase 4
Synonyms: p34PSK-J3/cdk4, Crk3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Nedd4
Name: neural precursor cell expressed, developmentally down-regulated 4
Synonyms: Nedd4-1, Nedd4, Nedd4a, E430025J12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17999
HGNC: HGNC:7727
Homologene: 134533
Sfrp1
Name: secreted frizzled-related protein 1
Synonyms: sFRP-1, 2210415K03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20377
Homologene: 2266
Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 24,237,219 bp
  • C to A, chromosome 1 at 40,000,680 bp
  • T to C, chromosome 1 at 57,411,802 bp
  • T to C, chromosome 1 at 58,466,062 bp
  • A to T, chromosome 1 at 96,837,517 bp
  • T to A, chromosome 1 at 156,033,836 bp
  • T to C, chromosome 1 at 170,794,007 bp
  • T to A, chromosome 1 at 172,109,913 bp
  • C to T, chromosome 2 at 58,567,442 bp
  • T to C, chromosome 2 at 118,919,208 bp
  • T to A, chromosome 2 at 126,325,407 bp
  • G to A, chromosome 2 at 132,872,091 bp
  • T to A, chromosome 2 at 155,549,518 bp
  • T to C, chromosome 2 at 167,301,340 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • A to T, chromosome 3 at 41,681,774 bp
  • T to C, chromosome 4 at 64,000,733 bp
  • A to G, chromosome 4 at 118,161,816 bp
  • T to A, chromosome 4 at 123,474,848 bp
  • C to A, chromosome 4 at 129,118,494 bp
  • A to C, chromosome 4 at 155,753,597 bp
  • G to T, chromosome 4 at 156,166,538 bp
  • T to C, chromosome 5 at 3,948,805 bp
  • A to T, chromosome 5 at 5,227,182 bp
  • G to A, chromosome 5 at 8,092,343 bp
  • T to C, chromosome 5 at 24,386,852 bp
  • C to A, chromosome 5 at 43,825,374 bp
  • T to A, chromosome 5 at 104,483,224 bp
  • T to A, chromosome 5 at 105,277,736 bp
  • T to C, chromosome 5 at 108,650,229 bp
  • A to T, chromosome 6 at 18,434,166 bp
  • T to A, chromosome 6 at 42,486,896 bp
  • A to G, chromosome 6 at 70,144,125 bp
  • A to T, chromosome 6 at 120,481,504 bp
  • A to G, chromosome 6 at 142,428,541 bp
  • G to A, chromosome 7 at 6,439,021 bp
  • G to A, chromosome 7 at 16,614,479 bp
  • A to T, chromosome 7 at 19,065,439 bp
  • C to T, chromosome 7 at 79,100,965 bp
  • A to T, chromosome 7 at 105,692,645 bp
  • A to G, chromosome 7 at 108,055,953 bp
  • T to G, chromosome 7 at 145,322,186 bp
  • A to G, chromosome 8 at 9,971,378 bp
  • T to C, chromosome 8 at 23,412,143 bp
  • G to A, chromosome 8 at 94,850,258 bp
  • A to G, chromosome 8 at 105,844,181 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • C to T, chromosome 9 at 39,647,200 bp
  • T to A, chromosome 9 at 72,726,426 bp
  • C to T, chromosome 10 at 5,604,208 bp
  • A to G, chromosome 10 at 79,666,632 bp
  • C to T, chromosome 10 at 94,910,586 bp
  • T to A, chromosome 10 at 127,064,677 bp
  • A to G, chromosome 10 at 128,269,843 bp
  • C to T, chromosome 10 at 129,802,353 bp
  • G to A, chromosome 11 at 55,282,903 bp
  • A to G, chromosome 11 at 58,436,779 bp
  • A to G, chromosome 11 at 84,964,551 bp
  • A to G, chromosome 11 at 94,570,385 bp
  • C to A, chromosome 11 at 120,377,359 bp
  • C to T, chromosome 12 at 13,432,922 bp
  • T to C, chromosome 12 at 53,140,344 bp
  • C to T, chromosome 12 at 57,728,410 bp
  • T to C, chromosome 12 at 70,346,891 bp
  • T to A, chromosome 12 at 84,162,328 bp
  • T to C, chromosome 12 at 98,852,693 bp
  • T to C, chromosome 13 at 21,555,999 bp
  • T to A, chromosome 13 at 22,524,834 bp
  • T to A, chromosome 13 at 40,887,728 bp
  • A to T, chromosome 13 at 108,256,786 bp
  • T to A, chromosome 14 at 6,387,488 bp
  • T to C, chromosome 14 at 54,711,664 bp
  • A to G, chromosome 14 at 63,191,778 bp
  • A to G, chromosome 14 at 122,737,912 bp
  • A to G, chromosome 15 at 4,035,324 bp
  • A to G, chromosome 15 at 38,015,123 bp
  • T to A, chromosome 15 at 83,101,698 bp
  • G to A, chromosome 15 at 83,856,268 bp
  • A to T, chromosome 15 at 101,477,276 bp
  • G to T, chromosome 16 at 20,618,648 bp
  • T to C, chromosome 16 at 23,974,966 bp
  • A to G, chromosome 16 at 34,971,409 bp
  • G to C, chromosome 16 at 76,292,305 bp
  • A to G, chromosome 17 at 15,807,486 bp
  • A to T, chromosome 17 at 23,386,762 bp
  • T to A, chromosome 17 at 26,120,400 bp
  • A to G, chromosome 17 at 33,958,075 bp
  • T to A, chromosome 17 at 36,461,353 bp
  • A to G, chromosome 17 at 45,566,747 bp
  • A to G, chromosome 17 at 78,971,454 bp
  • T to C, chromosome 18 at 36,993,188 bp
  • C to T, chromosome 19 at 8,609,666 bp
  • T to A, chromosome 19 at 40,363,216 bp
  • T to A, chromosome 19 at 48,749,371 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8956 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068792-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.