Strain Name:
C57BL/6J-MtgxR8956Btlr/Mmmh
Stock Number:
068792-MU
Citation ID:
RRID:MMRRC_068792-MU
Other Names:
R8956 (G1)
Major Collection:

Strain Information

B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Cdk4
Name: cyclin dependent kinase 4
Synonyms: p34PSK-J3/cdk4, Crk3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Nedd4
Name: neural precursor cell expressed, developmentally down-regulated 4
Synonyms: Nedd4-1, Nedd4, Nedd4a, E430025J12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17999
HGNC: HGNC:7727
Homologene: 134533
Sfrp1
Name: secreted frizzled-related protein 1
Synonyms: sFRP-1, 2210415K03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20377
Homologene: 2266
Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Madcam1
Name: mucosal vascular addressin cell adhesion molecule 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17123
VEGA: 10
HGNC: HGNC:6765
Homologene: 8413
Atf6
Name: activating transcription factor 6
Synonyms: ESTM49, 9130025P16Rik, Atf6alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226641
HGNC: HGNC:791
Homologene: 32015
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Map4k4
Name: mitogen-activated protein kinase kinase kinase kinase 4
Synonyms: Nik, 9430080K19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26921
HGNC: HGNC:6866
Homologene: 7442
Arhgap35
Name: Rho GTPase activating protein 35
Synonyms: P190 RhoGAP, 6430596G11Rik, p190RhoGAP, p190A, Grlf1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232906
HGNC: HGNC:4591
Homologene: 35136
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Orc2
Name: origin recognition complex, subunit 2
Synonyms: Orc2l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18393
HGNC: HGNC:8488
Homologene: 4512
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Bcl6
Name: B cell leukemia/lymphoma 6
Synonyms: Bcl5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12053
HGNC: HGNC:1001
Homologene: 7640
Nrip1
Name: nuclear receptor interacting protein 1
Synonyms: RIP140, 6030458L20Rik, 8430438I05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268903
HGNC: HGNC:8001
Homologene: 2606
Atad3a
Name: ATPase family, AAA domain containing 3A
Synonyms: Tob3, 2400004H09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108888
Homologene: 10059
Lig4
Name: ligase IV, DNA, ATP-dependent
Synonyms: DNA ligase IV, 5830471N16Rik, tiny
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319583
HGNC: HGNC:6601
Homologene: 1736
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Acsf2
Name: acyl-CoA synthetase family member 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 264895
Homologene: 23519
Pcca
Name: propionyl-Coenzyme A carboxylase, alpha polypeptide
Synonyms: C79630
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110821
HGNC: HGNC:8653
Homologene: 236
Pkd2
Name: polycystin 2, transient receptor potential cation channel
Synonyms: polycystin-2, C030034P18Rik, TRPP2, PC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18764
HGNC: HGNC:9009
Homologene: 20104
Gcnt2
Name: glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms: IGnTC, IGnTB, IGnTA, 5330430K10Rik, IGnT
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14538
VEGA: 13
HGNC: HGNC:4204
Homologene: 41535
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Kdm4a
Name: lysine (K)-specific demethylase 4A
Synonyms: Jmjd2, D4Ertd222e, JHDM3A, Jmjd2a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230674
Homologene: 27780
Mideas
Name: mitotic deacetylase associated SANT domain protein
Synonyms: 9430029N19Rik, C130039O16Rik, Elmsan1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238317
Homologene: 19330
Tor1aip1
Name: torsin A interacting protein 1
Synonyms: LAP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208263
Homologene: 9208
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Mrgprd
Name: MAS-related GPR, member D
Synonyms: MrgD, LOC211578
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211578
Homologene: 18893
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Car4
Name: carbonic anhydrase 4
Synonyms: CA IV
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12351
HGNC: HGNC:1375
Homologene: 20183
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619697
Homologene: 86604
Slc35b2
Name: solute carrier family 35, member B2
Synonyms: 1110003M08Rik, PAPST1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73836
VEGA: 17
Homologene: 24504
Faap100
Name: Fanconi anemia core complex associated protein 100
Synonyms: 2310003H01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71885
Homologene: 69394
Sclt1
Name: sodium channel and clathrin linker 1
Synonyms: 4931421F20Rik, 2610207F23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67161
Homologene: 27031
Il17ra
Name: interleukin 17 receptor A
Synonyms: VDw217, Il17r
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16172
HGNC: HGNC:5985
Homologene: 7378
Atg9b
Name: autophagy related 9B
Synonyms: LOC213948, eONE, Apg9l2, Nos3as
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213948
Homologene: 72638
Krt86
Name: keratin 86
Synonyms: MHb4, Krt2-11, Khb4, Krt2-10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16679
VEGA: 15
HGNC: HGNC:6463
Homologene: 1717
Or2r2
Name: olfactory receptor family 2 subfamily R member 2
Synonyms: GA_x6K02T2P3E9-5073878-5074816, MOR257-7P, Olfr456
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259144
Homologene: 79406
Cebpe
Name: CCAAT/enhancer binding protein epsilon
Synonyms: C/EBPe, C/EBPepsilon, CRP1, LOC239097
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110794
VEGA: 14
HGNC: HGNC:1836
Homologene: 1367
Col9a1
Name: collagen, type IX, alpha 1
Synonyms: Col9a-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12839
HGNC: HGNC:2217
Homologene: 1393
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Or2bd2
Name: olfactory receptor family 2 subfamily BD member 2
Synonyms: GA_x6K02T2QGBW-3169916-3170881, MOR124-1, 4930415J05Rik, Olfr1344
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257882
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Bst1
Name: bone marrow stromal cell antigen 1
Synonyms: 114/A10, Ly65, Bp3, Bsta1, CD157
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12182
HGNC: HGNC:1118
Homologene: 3198
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Dgkq
Name: diacylglycerol kinase, theta
Synonyms: 110kDa, Dagk4, DAGK7, Dgkd, Dgk theta
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 110524
HGNC: HGNC:2856
Homologene: 20352
H2-M10.4
Name: histocompatibility 2, M region locus 10.4
Synonyms: 15H
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224753
Homologene: 117973
Plxnc1
Name: plexin C1
Synonyms: vespr, 2510048K12Rik, CD232
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Neil2
Name: nei like 2 (E. coli)
Synonyms: LOC382913, NEH2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 382913
VEGA: 14
Homologene: 17032
Tsnaxip1
Name: translin-associated factor X (Tsnax) interacting protein 1
Synonyms: TXI1, 1700016K08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72236
Homologene: 10194
Gys2
Name: glycogen synthase 2
Synonyms: LGS, glycogen synthase, liver
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232493
HGNC: HGNC:4707
Homologene: 56580
Lrrn4
Name: leucine rich repeat neuronal 4
Synonyms: B430119L13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320974
Homologene: 17632
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Gm12253
Name: predicted gene 12253
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 624860
Homologene: 83331
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241633
Homologene: 133162
Slc22a8
Name: solute carrier family 22 (organic anion transporter), member 8
Synonyms: Roct, OAT3, mOat3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19879
VEGA: 19
Homologene: 20901
Mpped1
Name: metallophosphoesterase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223726
HGNC: HGNC:1306
Homologene: 15012
Or10d4c
Name: olfactory receptor family 10 subfamily D member 4C
Synonyms: GA_x6K02T2PVTD-33343617-33344561, MOR224-5, Olfr961
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258497
VEGA: 9
Homologene: 74020
Slco4c1
Name: solute carrier organic anion transporter family, member 4C1
Synonyms: SLC21A20, PRO2176, OATP4C1, OATP-M1, OATP-H, C330017E21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227394
Homologene: 62654
Vps52
Name: VPS52 GARP complex subunit
Synonyms: ARE1, tcl-w5, D430041K17Rik, Sacm2l, tclw5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224705
Homologene: 5756
Sorcs3
Name: sortilin-related VPS10 domain containing receptor 3
Synonyms: 6330404A12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66673
VEGA: 19
Homologene: 8986
Coq9
Name: coenzyme Q9
Synonyms: 2310005O14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67914
Homologene: 6477
Rsph6a
Name: radial spoke head 6 homolog A (Chlamydomonas)
Synonyms: RSP4, Rshl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83434
Homologene: 36476
Or10ab4
Name: olfactory receptor family 10 subfamily AB member 4
Synonyms: GA_x6K02T2PBJ9-10384085-10385068, MOR267-15, Olfr479
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257891
Homologene: 79346
Maip1
Name: matrix AAA peptidase interacting protein 1
Synonyms: 9430016H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68115
Homologene: 11565
Cdk14
Name: cyclin dependent kinase 14
Synonyms: Pftk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18647
HGNC: HGNC:8883
Homologene: 7888
Vmn1r203
Name: vomeronasal 1 receptor 203
Synonyms: V1rh11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171270
Homologene: 110880
Pgap6
Name: post-glycosylphosphatidylinositol attachment to proteins 6
Synonyms: M83, Tmem8, Rxylt1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 60455
Homologene: 10944
Myct1
Name: myc target 1
Synonyms: Mtmc1, MT-MC1, 1110020B04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68632
VEGA: 10
Homologene: 11833
Or6c215
Name: olfactory receptor family 6 subfamily C member 215
Synonyms: GA_x6K02T2PULF-11481207-11480248, MOR110-6, Olfr811
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258545
Homologene: 133725
Or2b7
Name: olfactory receptor family 2 subfamily B member 7
Synonyms: MOR256-36, GA_x6K02T2QHY8-11688984-11689964, MOR256-63, MOR256-36, Olfr1365, Olfr1535
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 404335
Homologene: 131356
Upp2
Name: uridine phosphorylase 2
Synonyms: UDRPASE2, UPASE2, UP2, 1700124F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76654
Homologene: 12654
Bahd1
Name: bromo adjacent homology domain containing 1
Synonyms: LOC228536
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228536
Homologene: 8976
Oxct1
Name: 3-oxoacid CoA transferase 1
Synonyms: 2610008O03Rik, Scot-s
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67041
HGNC: HGNC:8527
Homologene: 377
Acss2
Name: acyl-CoA synthetase short-chain family member 2
Synonyms: acetyl-CoA synthetase 1, ACAS, AceCS1, Acas1, Acs1, Acas2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60525
Homologene: 6469
Elovl7
Name: ELOVL fatty acid elongase 7
Synonyms: 9130013K24Rik, ELOVL family member 7, elongation of long chain fatty acids (yeast)
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74559
VEGA: 13
Homologene: 23672
Serhl
Name: serine hydrolase-like
Synonyms: 1110019M09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68607
Homologene: 65196
Rgmb
Name: repulsive guidance molecule family member B
Synonyms: 1110059F19Rik, DRAGON, RGM domain family, member B
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68799
VEGA: 17
Homologene: 65355
Apof
Name: apolipoprotein F
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103161
VEGA: 10
HGNC: HGNC:615
Homologene: 48030
Hpca
Name: hippocalcin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15444
HGNC: HGNC:5144
Homologene: 55634
Pcdha8
Name: protocadherin alpha 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353235
HGNC: HGNC:8675
Homologene: 129614
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Igkv8-28
Name: immunoglobulin kappa variable 8-28
Synonyms: ENSMUSG00000073023
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434040
HGNC: HGNC:5834
Gm43302
Name: predicted gene 43302
Type: Gene
Species: Mouse
Chromosome: 5
Eef1akmt4
Name: EEF1A lysine methyltransferase 4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110599566
VEGA: 16
Gm16440
Name: predicted gene 16440
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 544998
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 24,237,219 bp
  • C to A, chromosome 1 at 40,000,680 bp
  • T to C, chromosome 1 at 57,411,802 bp
  • T to C, chromosome 1 at 58,466,062 bp
  • A to T, chromosome 1 at 96,837,517 bp
  • T to A, chromosome 1 at 156,033,836 bp
  • T to C, chromosome 1 at 170,794,007 bp
  • T to A, chromosome 1 at 172,109,913 bp
  • C to T, chromosome 2 at 58,567,442 bp
  • T to C, chromosome 2 at 118,919,208 bp
  • T to A, chromosome 2 at 126,325,407 bp
  • G to A, chromosome 2 at 132,872,091 bp
  • T to A, chromosome 2 at 155,549,518 bp
  • T to C, chromosome 2 at 167,301,340 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • A to T, chromosome 3 at 41,681,774 bp
  • T to C, chromosome 4 at 64,000,733 bp
  • A to G, chromosome 4 at 118,161,816 bp
  • T to A, chromosome 4 at 123,474,848 bp
  • C to A, chromosome 4 at 129,118,494 bp
  • A to C, chromosome 4 at 155,753,597 bp
  • G to T, chromosome 4 at 156,166,538 bp
  • T to C, chromosome 5 at 3,948,805 bp
  • A to T, chromosome 5 at 5,227,182 bp
  • G to A, chromosome 5 at 8,092,343 bp
  • T to C, chromosome 5 at 24,386,852 bp
  • C to A, chromosome 5 at 43,825,374 bp
  • T to A, chromosome 5 at 104,483,224 bp
  • T to A, chromosome 5 at 105,277,736 bp
  • T to C, chromosome 5 at 108,650,229 bp
  • A to T, chromosome 6 at 18,434,166 bp
  • T to A, chromosome 6 at 42,486,896 bp
  • A to G, chromosome 6 at 70,144,125 bp
  • A to T, chromosome 6 at 120,481,504 bp
  • A to G, chromosome 6 at 142,428,541 bp
  • G to A, chromosome 7 at 6,439,021 bp
  • G to A, chromosome 7 at 16,614,479 bp
  • A to T, chromosome 7 at 19,065,439 bp
  • C to T, chromosome 7 at 79,100,965 bp
  • A to T, chromosome 7 at 105,692,645 bp
  • A to G, chromosome 7 at 108,055,953 bp
  • T to G, chromosome 7 at 145,322,186 bp
  • A to G, chromosome 8 at 9,971,378 bp
  • T to C, chromosome 8 at 23,412,143 bp
  • G to A, chromosome 8 at 94,850,258 bp
  • A to G, chromosome 8 at 105,844,181 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • C to T, chromosome 9 at 39,647,200 bp
  • T to A, chromosome 9 at 72,726,426 bp
  • C to T, chromosome 10 at 5,604,208 bp
  • A to G, chromosome 10 at 79,666,632 bp
  • C to T, chromosome 10 at 94,910,586 bp
  • T to A, chromosome 10 at 127,064,677 bp
  • A to G, chromosome 10 at 128,269,843 bp
  • C to T, chromosome 10 at 129,802,353 bp
  • G to A, chromosome 11 at 55,282,903 bp
  • A to G, chromosome 11 at 58,436,779 bp
  • A to G, chromosome 11 at 84,964,551 bp
  • A to G, chromosome 11 at 94,570,385 bp
  • C to A, chromosome 11 at 120,377,359 bp
  • C to T, chromosome 12 at 13,432,922 bp
  • T to C, chromosome 12 at 53,140,344 bp
  • C to T, chromosome 12 at 57,728,410 bp
  • T to C, chromosome 12 at 70,346,891 bp
  • T to A, chromosome 12 at 84,162,328 bp
  • T to C, chromosome 12 at 98,852,693 bp
  • T to C, chromosome 13 at 21,555,999 bp
  • T to A, chromosome 13 at 22,524,834 bp
  • T to A, chromosome 13 at 40,887,728 bp
  • A to T, chromosome 13 at 108,256,786 bp
  • T to A, chromosome 14 at 6,387,488 bp
  • T to C, chromosome 14 at 54,711,664 bp
  • A to G, chromosome 14 at 63,191,778 bp
  • A to G, chromosome 14 at 122,737,912 bp
  • A to G, chromosome 15 at 4,035,324 bp
  • A to G, chromosome 15 at 38,015,123 bp
  • T to A, chromosome 15 at 83,101,698 bp
  • G to A, chromosome 15 at 83,856,268 bp
  • A to T, chromosome 15 at 101,477,276 bp
  • G to T, chromosome 16 at 20,618,648 bp
  • T to C, chromosome 16 at 23,974,966 bp
  • A to G, chromosome 16 at 34,971,409 bp
  • G to C, chromosome 16 at 76,292,305 bp
  • A to G, chromosome 17 at 15,807,486 bp
  • A to T, chromosome 17 at 23,386,762 bp
  • T to A, chromosome 17 at 26,120,400 bp
  • A to G, chromosome 17 at 33,958,075 bp
  • T to A, chromosome 17 at 36,461,353 bp
  • A to G, chromosome 17 at 45,566,747 bp
  • A to G, chromosome 17 at 78,971,454 bp
  • T to C, chromosome 18 at 36,993,188 bp
  • C to T, chromosome 19 at 8,609,666 bp
  • T to A, chromosome 19 at 40,363,216 bp
  • T to A, chromosome 19 at 48,749,371 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8956 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068792-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.