Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8970Btlr/Mmmh
Stock Number:
068804-MU
Citation ID:
RRID:MMRRC_068804-MU
Other Names:
R8970 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Th
Name: tyrosine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21823
Homologene: 307
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Gpr139
Name: G protein-coupled receptor 139
Synonyms: LOC209776, GPRg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 209776
Homologene: 45860
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 59,069,736 bp
  • A to G, chromosome 1 at 72,652,337 bp
  • A to T, chromosome 1 at 83,023,101 bp
  • G to C, chromosome 1 at 93,159,811 bp
  • A to T, chromosome 1 at 93,188,965 bp
  • G to A, chromosome 1 at 131,298,366 bp
  • A to G, chromosome 1 at 134,324,551 bp
  • T to C, chromosome 2 at 25,445,716 bp
  • T to A, chromosome 2 at 37,085,466 bp
  • G to T, chromosome 2 at 120,464,085 bp
  • A to G, chromosome 2 at 122,357,173 bp
  • T to C, chromosome 2 at 168,189,370 bp
  • T to C, chromosome 2 at 170,115,077 bp
  • G to T, chromosome 3 at 37,404,618 bp
  • T to C, chromosome 3 at 89,069,000 bp
  • T to A, chromosome 3 at 153,869,732 bp
  • G to A, chromosome 4 at 46,170,023 bp
  • T to C, chromosome 4 at 63,215,868 bp
  • A to G, chromosome 4 at 152,291,579 bp
  • T to C, chromosome 5 at 94,537,786 bp
  • G to A, chromosome 5 at 118,745,099 bp
  • C to T, chromosome 5 at 120,544,453 bp
  • C to T, chromosome 5 at 123,917,216 bp
  • G to A, chromosome 5 at 130,269,224 bp
  • C to T, chromosome 5 at 132,258,952 bp
  • C to A, chromosome 6 at 38,680,187 bp
  • A to G, chromosome 6 at 118,392,331 bp
  • T to A, chromosome 6 at 121,389,569 bp
  • A to G, chromosome 6 at 128,568,763 bp
  • A to T, chromosome 6 at 148,933,126 bp
  • T to C, chromosome 7 at 4,580,945 bp
  • A to G, chromosome 7 at 4,776,182 bp
  • T to C, chromosome 7 at 11,610,487 bp
  • T to C, chromosome 7 at 12,694,705 bp
  • T to C, chromosome 7 at 100,419,764 bp
  • A to T, chromosome 7 at 106,163,440 bp
  • A to G, chromosome 7 at 108,565,790 bp
  • A to G, chromosome 7 at 119,144,811 bp
  • A to C, chromosome 7 at 125,673,055 bp
  • A to G, chromosome 7 at 142,893,059 bp
  • A to G, chromosome 8 at 4,186,154 bp
  • A to G, chromosome 8 at 31,094,204 bp
  • A to T, chromosome 8 at 65,036,949 bp
  • T to A, chromosome 8 at 106,689,239 bp
  • T to C, chromosome 9 at 62,426,527 bp
  • T to C, chromosome 9 at 67,945,521 bp
  • A to G, chromosome 9 at 70,748,176 bp
  • G to A, chromosome 10 at 88,126,324 bp
  • T to C, chromosome 10 at 93,489,174 bp
  • T to C, chromosome 10 at 130,386,375 bp
  • T to A, chromosome 11 at 7,149,983 bp
  • A to G, chromosome 11 at 85,178,420 bp
  • A to T, chromosome 11 at 87,742,819 bp
  • C to T, chromosome 11 at 100,379,565 bp
  • A to G, chromosome 11 at 100,880,527 bp
  • T to A, chromosome 13 at 92,439,082 bp
  • A to G, chromosome 14 at 62,419,215 bp
  • T to A, chromosome 14 at 75,125,191 bp
  • T to A, chromosome 15 at 25,803,381 bp
  • A to T, chromosome 16 at 42,174,165 bp
  • A to T, chromosome 16 at 87,416,038 bp
  • G to T, chromosome 17 at 18,074,177 bp
  • T to C, chromosome 17 at 28,599,519 bp
  • T to G, chromosome 17 at 33,002,836 bp
  • A to T, chromosome 17 at 36,873,276 bp
  • A to G, chromosome 17 at 55,897,836 bp
  • A to G, chromosome 17 at 56,423,353 bp
  • T to A, chromosome 17 at 84,767,055 bp
  • T to A, chromosome 18 at 37,752,578 bp
  • A to G, chromosome 19 at 10,608,444 bp
  • T to A, chromosome 19 at 12,998,989 bp
  • T to G, chromosome 19 at 13,375,753 bp
  • T to A, chromosome 19 at 46,137,101 bp
  • T to C, chromosome 19 at 55,203,046 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8970 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068804-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.