Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8970Btlr/Mmmh
Stock Number:
068804-MU
Citation ID:
RRID:MMRRC_068804-MU
Other Names:
R8970 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Th
Name: tyrosine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21823
Homologene: 307
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Gpr139
Name: G protein-coupled receptor 139
Synonyms: LOC209776, GPRg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 209776
Homologene: 45860
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Denr
Name: density-regulated protein
Synonyms: 1500003K04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68184
HGNC: HGNC:2769
Homologene: 6275
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Auts2
Name: autism susceptibility candidate 2
Synonyms: D830032G16Rik, A730011F23Rik, 2700063G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319974
Homologene: 22907
Tyw1
Name: tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms: Rsafd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100929
Homologene: 7068
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Tango6
Name: transport and golgi organization 6
Synonyms: Tango6, Tmco7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 272538
Homologene: 52121
Ncbp1
Name: nuclear cap binding protein subunit 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433702
HGNC: HGNC:7658
Homologene: 1859
Ddb1
Name: damage specific DNA binding protein 1
Synonyms: p127-Ddb1, damage-specific DNA-binding protein, DNA repair, DNA repair protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13194
VEGA: 19
HGNC: HGNC:2717
Homologene: 1448
Lrpprc
Name: leucine-rich PPR-motif containing
Synonyms: Lrp130, 3110001K13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72416
Homologene: 32695
Adnp
Name: activity-dependent neuroprotective protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11538
Homologene: 7617
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Iqsec3
Name: IQ motif and Sec7 domain 3
Synonyms: BRAG3, synarfGEF
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243621
Homologene: 46091
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Sinhcaf
Name: SIN3-HDAC complex associated factor
Synonyms: Tera, Pptcs1, Fam60a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56306
Homologene: 10494
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218440
Homologene: 18450
Jup
Name: junction plakoglobin
Synonyms: PG, plakoglobin, gamma-catenin, D930025P04Rik, Ctnng
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: PTP-NU3, PTPsigma, RPTPsigma, Ptpt9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Shf
Name: Src homology 2 domain containing F
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 435684
Homologene: 44524
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20850
Homologene: 20680
Chct1
Name: CHD1 helical C-terminal domain containing 1
Synonyms: 1700125H20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73634
Homologene: 18763
Pitx3
Name: paired-like homeodomain transcription factor 3
Synonyms: Ptx3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18742
HGNC: HGNC:9006
Homologene: 3689
Msh4
Name: mutS homolog 4
Synonyms: mMsh4, 4930485C04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55993
HGNC: HGNC:7327
Homologene: 1830
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Il11
Name: interleukin 11
Synonyms: IL-11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16156
HGNC: HGNC:5966
Homologene: 535
Mab21l4
Name: mab-21-like 4
Synonyms: 2310007B03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71874
Homologene: 11761
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: 1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Dusp26
Name: dual specificity phosphatase 26
Synonyms: 2310043K02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66959
Homologene: 11421
Gucy2g
Name: guanylate cyclase 2g
Synonyms: 2410077I05Rik, GC-G
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73707
Homologene: 44544
Hal
Name: histidine ammonia lyase
Synonyms: histidase, Hsd
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15109
HGNC: HGNC:4806
Homologene: 68229
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319695
Homologene: 85163
Capn3
Name: calpain 3
Synonyms: Capa-3, Capa3, Lp82, p94
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12335
HGNC: HGNC:1480
Homologene: 52
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625068
Homologene: 129606
Vmn2r56
Name: vomeronasal 2, receptor 56
Synonyms: EG629079
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 629079
Homologene: 104040
Trim10
Name: tripartite motif-containing 10
Synonyms: Herf1, Rnf9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19824
Homologene: 4932
Zfp217
Name: zinc finger protein 217
Synonyms: 4933431C08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228913
Homologene: 4757
Adam10
Name: a disintegrin and metallopeptidase domain 10
Synonyms: kuz, kuzbanian, 1700031C13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11487
HGNC: HGNC:188
Homologene: 865
Abca2
Name: ATP-binding cassette, sub-family A member 2
Synonyms: Abc2, D2H0S1474E
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11305
HGNC: HGNC:32
Homologene: 55590
Zfp959
Name: zinc finger protein 959
Synonyms: BC011426
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224893
Homologene: 138295
Parpbp
Name: PARP1 binding protein
Synonyms: 4930547N16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75317
Homologene: 49519
Gucy1b2
Name: guanylate cyclase 1, soluble, beta 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239134
HGNC: HGNC:4686
Homologene: 136630
Evi5l
Name: ecotropic viral integration site 5 like
Synonyms: 3110007G05Rik, 1700084G18Rik, 2310039H16Rik, B130050I23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213027
Homologene: 134635
Or56b1b
Name: olfactory receptor family 56 subfamily B member 1B
Synonyms: GA_x6K02T2PBJ9-10895499-10894543, MOR40-7P, MOR40-15, Olfr504
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258163
Homologene: 17189
Or5b99
Name: olfactory receptor family 5 subfamily B member 99
Synonyms: GA_x6K02T2RE5P-3328502-3329434, MOR202-1, Olfr1451
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258700
HGNC: HGNC:8323
Homologene: 128082
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Gm7196, Vmn2r-ps113
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 637021
Homologene: 115024
Crocc2
Name: ciliary rootlet coiled-coil, rootletin family member 2
Synonyms: LOC381284, E030010N08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381284
Homologene: 141152
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Coro2b
Name: coronin, actin binding protein, 2B
Synonyms: E130012P22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235431
HGNC: HGNC:2256
Homologene: 21228
Slc19a3
Name: solute carrier family 19, member 3
Synonyms: ThTr2, A230084E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 80721
Homologene: 23530
Clec2l
Name: C-type lectin domain family 2, member L
Synonyms: LOC381758
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 665180
VEGA: 6
Homologene: 35527
Zfp952
Name: zinc finger protein 952
Synonyms: C920016K16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240067
Homologene: 128790
Or12k8
Name: olfactory receptor family 12 subfamily K member 8
Synonyms: GA_x6K02T2NLDC-33777519-33776551, MOR159-3, Olfr361
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258365
Homologene: 27142
Supt4a
Name: SPT4A, DSIF elongation factor subunit
Synonyms: Supt4h, Supt4h1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20922
Homologene: 68303
Lsamp
Name: limbic system-associated membrane protein
Synonyms: Lamp, Lam, B130007O04Rik, D930023J12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268890
HGNC: HGNC:6705
Homologene: 20533
C2cd6
Name: C2 calcium dependent domain containing 6
Synonyms: 1700052H20Rik, 4930408G06Rik, Als2cr11, Als2cr11b, Gm33589, C2cd6b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73463
Homologene: 134310
Pcdhgb7
Name: protocadherin gamma subfamily B, 7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93704
HGNC: HGNC:8714
Homologene: 75102
Hes3
Name: hes family bHLH transcription factor 3
Synonyms: bHLHb43
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15207
Homologene: 7358
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Apela
Name: apelin receptor early endogenous ligand
Synonyms: Ende, Gm10664, Ela, Elabela
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100038489
Gvin1
Name: GTPase, very large interferon inducible 1
Synonyms: VLIG-1, 9830104F22Rik, VLIG, 9130002C22Rik, Iigs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74558
Homologene: 32708
Fgf2
Name: fibroblast growth factor 2
Synonyms: bFGF, Fgf-2, Fgfb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14173
HGNC: HGNC:3676
Homologene: 1521
Or5b114
Name: olfactory receptor family 5 subfamily B member 114
Synonyms: GA_x6K02T2RE5P-3706029-3706953, MOR202-21, Or5b114-ps1, Olfr1468-ps1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258192
Zscan4-ps3
Name: zinc finger and SCAN domain containing 4, pseudogene 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043042
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 59,069,736 bp
  • A to G, chromosome 1 at 72,652,337 bp
  • A to T, chromosome 1 at 83,023,101 bp
  • G to C, chromosome 1 at 93,159,811 bp
  • A to T, chromosome 1 at 93,188,965 bp
  • G to A, chromosome 1 at 131,298,366 bp
  • A to G, chromosome 1 at 134,324,551 bp
  • T to C, chromosome 2 at 25,445,716 bp
  • T to A, chromosome 2 at 37,085,466 bp
  • G to T, chromosome 2 at 120,464,085 bp
  • A to G, chromosome 2 at 122,357,173 bp
  • T to C, chromosome 2 at 168,189,370 bp
  • T to C, chromosome 2 at 170,115,077 bp
  • G to T, chromosome 3 at 37,404,618 bp
  • T to C, chromosome 3 at 89,069,000 bp
  • T to A, chromosome 3 at 153,869,732 bp
  • G to A, chromosome 4 at 46,170,023 bp
  • T to C, chromosome 4 at 63,215,868 bp
  • A to G, chromosome 4 at 152,291,579 bp
  • T to C, chromosome 5 at 94,537,786 bp
  • G to A, chromosome 5 at 118,745,099 bp
  • C to T, chromosome 5 at 120,544,453 bp
  • C to T, chromosome 5 at 123,917,216 bp
  • G to A, chromosome 5 at 130,269,224 bp
  • C to T, chromosome 5 at 132,258,952 bp
  • C to A, chromosome 6 at 38,680,187 bp
  • A to G, chromosome 6 at 118,392,331 bp
  • T to A, chromosome 6 at 121,389,569 bp
  • A to G, chromosome 6 at 128,568,763 bp
  • A to T, chromosome 6 at 148,933,126 bp
  • T to C, chromosome 7 at 4,580,945 bp
  • A to G, chromosome 7 at 4,776,182 bp
  • T to C, chromosome 7 at 11,610,487 bp
  • T to C, chromosome 7 at 12,694,705 bp
  • T to C, chromosome 7 at 100,419,764 bp
  • A to T, chromosome 7 at 106,163,440 bp
  • A to G, chromosome 7 at 108,565,790 bp
  • A to G, chromosome 7 at 119,144,811 bp
  • A to C, chromosome 7 at 125,673,055 bp
  • A to G, chromosome 7 at 142,893,059 bp
  • A to G, chromosome 8 at 4,186,154 bp
  • A to G, chromosome 8 at 31,094,204 bp
  • A to T, chromosome 8 at 65,036,949 bp
  • T to A, chromosome 8 at 106,689,239 bp
  • T to C, chromosome 9 at 62,426,527 bp
  • T to C, chromosome 9 at 67,945,521 bp
  • A to G, chromosome 9 at 70,748,176 bp
  • G to A, chromosome 10 at 88,126,324 bp
  • T to C, chromosome 10 at 93,489,174 bp
  • T to C, chromosome 10 at 130,386,375 bp
  • T to A, chromosome 11 at 7,149,983 bp
  • A to G, chromosome 11 at 85,178,420 bp
  • A to T, chromosome 11 at 87,742,819 bp
  • C to T, chromosome 11 at 100,379,565 bp
  • A to G, chromosome 11 at 100,880,527 bp
  • T to A, chromosome 13 at 92,439,082 bp
  • A to G, chromosome 14 at 62,419,215 bp
  • T to A, chromosome 14 at 75,125,191 bp
  • T to A, chromosome 15 at 25,803,381 bp
  • A to T, chromosome 16 at 42,174,165 bp
  • A to T, chromosome 16 at 87,416,038 bp
  • G to T, chromosome 17 at 18,074,177 bp
  • T to C, chromosome 17 at 28,599,519 bp
  • T to G, chromosome 17 at 33,002,836 bp
  • A to T, chromosome 17 at 36,873,276 bp
  • A to G, chromosome 17 at 55,897,836 bp
  • A to G, chromosome 17 at 56,423,353 bp
  • T to A, chromosome 17 at 84,767,055 bp
  • T to A, chromosome 18 at 37,752,578 bp
  • A to G, chromosome 19 at 10,608,444 bp
  • T to A, chromosome 19 at 12,998,989 bp
  • T to G, chromosome 19 at 13,375,753 bp
  • T to A, chromosome 19 at 46,137,101 bp
  • T to C, chromosome 19 at 55,203,046 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8970 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068804-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.