Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8972Btlr/Mmmh
Stock Number:
068806-MU
Citation ID:
RRID:MMRRC_068806-MU
Other Names:
R8972 (G1)
Major Collection:

Strain Information

Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Kif2a
Name: kinesin family member 2A
Synonyms: Kns2, Kif2, M-kinesin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16563
HGNC: HGNC:6318
Homologene: 3320
Usp28
Name: ubiquitin specific peptidase 28
Synonyms: 9830148O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235323
VEGA: 9
Homologene: 10840
Map4
Name: microtubule-associated protein 4
Synonyms: MAP 4, Mtap4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Usf1
Name: upstream transcription factor 1
Synonyms: upstream stimulatory factor, bHLHb11
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22278
Homologene: 31426
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, D9Ertd809e, Dopey1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Hmgxb4
Name: HMG box domain containing 4
Synonyms: 4733401K04Rik, Hmgb2l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70823
HGNC: HGNC:5003
Homologene: 4007
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231214
Homologene: 18159
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Csf2rb2
Name: colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
Synonyms: AIC2A, Il3r, Il3rb2, Bil3, BetaIl3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12984
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Wnt2b
Name: wingless-type MMTV integration site family, member 2B
Synonyms: Wnt13
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22414
Homologene: 22526
Mybbp1a
Name: MYB binding protein (P160) 1a
Synonyms: p67MBP, p160MBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18432
HGNC: HGNC:7546
Homologene: 40954
Crebbp
Name: CREB binding protein
Synonyms: CBP, KAT3A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12914
HGNC: HGNC:2348
Homologene: 68393
Ccdc187
Name: coiled-coil domain containing 187
Synonyms: 4932418E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329366
Homologene: 77630
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
Ccdc88a
Name: coiled coil domain containing 88A
Synonyms: C330012F17Rik, D130005J21Rik, C130096N06Rik, GIV, A430106J12Rik, HkRP1, Girdin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108686
Homologene: 41180
G2e3
Name: G2/M-phase specific E3 ubiquitin ligase
Synonyms: D930034K21Rik, 6030408C04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217558
Homologene: 32362
Tsku
Name: tsukushi, small leucine rich proteoglycan
Synonyms: 9530051K01Rik, Lrrc54
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244152
Homologene: 41045
Baiap3
Name: BAI1-associated protein 3
Synonyms: LOC381076
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545192
HGNC: HGNC:948
Homologene: 20844
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67196
Homologene: 40929
Anapc4
Name: anaphase promoting complex subunit 4
Synonyms: 2610306D21Rik, APC4, D5Ertd249e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52206
Homologene: 40873
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Sox6
Name: SRY (sex determining region Y)-box 6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20679
Homologene: 22631
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: 6530403F17Rik, A530023E23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Acss3
Name: acyl-CoA synthetase short-chain family member 3
Synonyms: LOC380660, 8430416H19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380660
Homologene: 11587
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Cntn1
Name: contactin 1
Synonyms: CNTN, F3cam, usl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12805
HGNC: HGNC:2171
Homologene: 7274
Gucy2g
Name: guanylate cyclase 2g
Synonyms: 2410077I05Rik, GC-G
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73707
Homologene: 44544
Ssu2
Name: ssu-2 homolog
Synonyms: D630042P16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243612
Homologene: 136556
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Csf2ra
Name: colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Synonyms: CD116, Csfgmra, GM-CSF-Ra, GM-CSFRalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12982
VEGA: 19
HGNC: HGNC:2435
Homologene: 48406
Tram2
Name: translocating chain-associating membrane protein 2
Synonyms: C330003D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170829
Homologene: 8183
Acss1
Name: acyl-CoA synthetase short-chain family member 1
Synonyms: 1110032O15Rik, AceCS2, Acas2, Acas2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68738
Homologene: 56037
Kansl1l
Name: KAT8 regulatory NSL complex subunit 1-like
Synonyms: C430010P07Rik, 1110028C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68691
Homologene: 27376
Tas2r123
Name: taste receptor, type 2, member 123
Synonyms: T2R23, Tas2r23, STC 9-2, mGR23, mt2r55
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353167
Homologene: 45450
Adgre4
Name: adhesion G protein-coupled receptor E4
Synonyms: EGF-TM7, D17Ertd479e, FIRE, Gpr127, Emr4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52614
VEGA: 17
Homologene: 64640
Zmynd15
Name: zinc finger, MYND-type containing 15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 574428
Homologene: 12995
Twnk
Name: twinkle mtDNA helicase
Synonyms: twinkle, Twinl, D19Ertd626e, Peo1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226153
VEGA: 19
HGNC: HGNC:1160
Homologene: 11052
Psg21
Name: pregnancy-specific beta-1-glycoprotein 21
Synonyms: cea8, 1600019C01Rik, 1600026N13Rik, 1600025N01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72242
Homologene: 110989
Asap2
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms: LOC385250, Ddef2, 6530401G17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211914
HGNC: HGNC:2721
Homologene: 2888
Mucl2
Name: mucin-like 2
Synonyms: Spt-1, Spt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20770
Homologene: 137219
Fap
Name: fibroblast activation protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14089
HGNC: HGNC:3590
Homologene: 48282
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Smg9
Name: SMG9 nonsense mediated mRNA decay factor
Synonyms: N28092, 1500002O20Rik, smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71997
Homologene: 10426
Prss3
Name: serine protease 3
Synonyms: Tb, TRY4, MTG, mesotrypsin, Try3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22073
Homologene: 88408
Zfp974
Name: zinc finger protein 974
Synonyms: 1700049G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73430
Or8d2b
Name: olfactory receptor family 8 subfamily D member 2D
Synonyms: GA_x6K02T2PVTD-32573036-32573962, MOR171-8, Olfr926
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258811
VEGA: 9
HGNC: HGNC:8482
Homologene: 128215
Cep250
Name: centrosomal protein 250
Synonyms: Inmp, B230210E21Rik, Cep2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Or4a67
Name: olfactory receptor family 4 subfamily A member 67
Synonyms: GA_x6K02T2Q125-50243231-50242221, MOR225-12, Olfr1200
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257887
Homologene: 123770
Arhgef39
Name: Rho guanine nucleotide exchange factor 39
Synonyms: E130306D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230098
Homologene: 19225
Nlrp4f
Name: NLR family, pyrin domain containing 4F
Synonyms: Nalp-kappa, C330026N02Rik, Nalp4f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97895
VEGA: 13
Homologene: 87252
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71481
Homologene: 11849
Mrgprb3
Name: MAS-related GPR, member B3
Synonyms: MrgB3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404238
Homologene: 138632
Sncb
Name: synuclein, beta
Synonyms: betaSYN
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 104069
Homologene: 2320
Mill1
Name: MHC I like leukocyte 1
Synonyms: 5530400I18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 266815
Homologene: 105329
Pira2
Name: paired-Ig-like receptor A2
Synonyms: 6M23
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18725
Homologene: 134028
Or8d1
Name: olfactory receptor family 8 subfamily D member 1
Synonyms: MTPCR09, MOR171-9, GA_x6K02T2PVTD-32550930-32551856, Olfr26
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18324
VEGA: 9
HGNC: HGNC:8481
Homologene: 79676
Gatd3a
Name: glutamine amidotransferase like class 1 domain containing 3A
Synonyms: D10Jhu81e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28295
VEGA: 10
HGNC: HGNC:1273
Homologene: 3416
Phc3
Name: polyhomeotic 3
Synonyms: EDR3, HPH3, E030046K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241915
Homologene: 69390
Krtap6-5
Name: keratin associated protein 6-5
Synonyms: 1110002D05Rik, Krtap16-8
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68484
VEGA: 16
Vmn2r31
Name: vomeronasal 2, receptor 31
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042591
Homologene: 113703
Vmn2r42
Name: vomeronasal 2, receptor 42
Synonyms: V2r4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22310
Homologene: 113703
Or13a23
Name: olfactory receptor family 13 subfamily A member 23
Synonyms: GA_x6K02T2PBJ9-42687904-42688835, MOR253-11P, MOR253-15_p, Or13a23-ps1, Olfr537-ps1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258200
Tcta
Name: T cell leukemia translocation altered gene
Synonyms: C85065, 9130410M22Rik, Tctal
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102791
Homologene: 11161
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 21,004,049 bp
  • C to T, chromosome 1 at 66,772,942 bp
  • C to T, chromosome 1 at 134,971,932 bp
  • C to T, chromosome 1 at 171,417,784 bp
  • A to T, chromosome 2 at 26,281,067 bp
  • A to G, chromosome 2 at 62,548,583 bp
  • A to C, chromosome 2 at 88,768,286 bp
  • G to T, chromosome 2 at 150,642,889 bp
  • C to T, chromosome 2 at 155,970,122 bp
  • C to T, chromosome 2 at 166,867,333 bp
  • T to A, chromosome 3 at 30,961,777 bp
  • T to C, chromosome 3 at 104,951,159 bp
  • A to G, chromosome 3 at 127,679,583 bp
  • T to C, chromosome 4 at 43,497,185 bp
  • A to G, chromosome 5 at 43,710,542 bp
  • T to A, chromosome 5 at 52,850,542 bp
  • T to C, chromosome 5 at 112,693,298 bp
  • A to T, chromosome 6 at 31,496,746 bp
  • T to A, chromosome 6 at 41,376,938 bp
  • G to T, chromosome 6 at 67,896,345 bp
  • G to A, chromosome 6 at 112,383,937 bp
  • T to C, chromosome 6 at 132,847,370 bp
  • T to C, chromosome 7 at 3,842,071 bp
  • T to A, chromosome 7 at 7,396,655 bp
  • A to G, chromosome 7 at 8,184,332 bp
  • T to C, chromosome 7 at 18,263,057 bp
  • T to C, chromosome 7 at 18,647,368 bp
  • A to T, chromosome 7 at 24,420,630 bp
  • T to C, chromosome 7 at 27,911,164 bp
  • A to T, chromosome 7 at 48,643,674 bp
  • C to A, chromosome 7 at 98,352,497 bp
  • C to A, chromosome 7 at 115,476,983 bp
  • C to A, chromosome 7 at 135,695,635 bp
  • A to T, chromosome 7 at 140,539,125 bp
  • T to A, chromosome 8 at 36,938,240 bp
  • T to A, chromosome 8 at 75,021,838 bp
  • A to G, chromosome 9 at 38,855,958 bp
  • G to A, chromosome 9 at 38,877,854 bp
  • T to A, chromosome 9 at 42,046,552 bp
  • T to A, chromosome 9 at 49,037,824 bp
  • T to C, chromosome 9 at 51,849,011 bp
  • T to C, chromosome 9 at 86,521,247 bp
  • T to C, chromosome 9 at 108,304,134 bp
  • T to A, chromosome 9 at 110,035,117 bp
  • G to T, chromosome 10 at 52,123,237 bp
  • T to C, chromosome 10 at 78,167,489 bp
  • T to C, chromosome 10 at 107,084,922 bp
  • C to T, chromosome 11 at 9,328,138 bp
  • T to G, chromosome 11 at 29,485,888 bp
  • T to G, chromosome 11 at 49,216,065 bp
  • C to A, chromosome 11 at 59,052,616 bp
  • T to C, chromosome 11 at 70,464,239 bp
  • T to A, chromosome 11 at 72,446,250 bp
  • T to C, chromosome 11 at 72,900,673 bp
  • C to T, chromosome 12 at 21,229,248 bp
  • T to A, chromosome 12 at 51,363,494 bp
  • T to C, chromosome 12 at 78,609,239 bp
  • T to A, chromosome 13 at 54,759,959 bp
  • T to C, chromosome 13 at 65,182,935 bp
  • T to C, chromosome 13 at 106,979,035 bp
  • C to A, chromosome 14 at 67,776,300 bp
  • T to C, chromosome 15 at 76,597,328 bp
  • T to C, chromosome 15 at 78,287,915 bp
  • T to G, chromosome 15 at 92,252,397 bp
  • T to A, chromosome 15 at 103,897,594 bp
  • C to T, chromosome 16 at 4,108,071 bp
  • C to T, chromosome 16 at 89,047,719 bp
  • G to A, chromosome 16 at 89,813,006 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • G to T, chromosome 17 at 25,247,036 bp
  • A to T, chromosome 17 at 46,543,251 bp
  • G to T, chromosome 17 at 55,802,189 bp
  • A to C, chromosome 17 at 74,702,318 bp
  • T to C, chromosome 19 at 45,011,710 bp
  • A to G, chromosome 19 at 55,237,974 bp
  • A to T, chromosome 19 at 61,225,159 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8972 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068806-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.