Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8972Btlr/Mmmh
Stock Number:
068806-MU
Citation ID:
RRID:MMRRC_068806-MU
Other Names:
R8972 (G1)
Major Collection:

Strain Information

Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Kif2a
Name: kinesin family member 2A
Synonyms: Kns2, Kif2, M-kinesin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16563
HGNC: HGNC:6318
Homologene: 3320
Usp28
Name: ubiquitin specific peptidase 28
Synonyms: 9830148O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235323
VEGA: 9
Homologene: 10840
Map4
Name: microtubule-associated protein 4
Synonyms: MAP 4, Mtap4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 21,004,049 bp
  • C to T, chromosome 1 at 66,772,942 bp
  • C to T, chromosome 1 at 134,971,932 bp
  • C to T, chromosome 1 at 171,417,784 bp
  • A to T, chromosome 2 at 26,281,067 bp
  • A to G, chromosome 2 at 62,548,583 bp
  • A to C, chromosome 2 at 88,768,286 bp
  • G to T, chromosome 2 at 150,642,889 bp
  • C to T, chromosome 2 at 155,970,122 bp
  • C to T, chromosome 2 at 166,867,333 bp
  • T to A, chromosome 3 at 30,961,777 bp
  • T to C, chromosome 3 at 104,951,159 bp
  • A to G, chromosome 3 at 127,679,583 bp
  • T to C, chromosome 4 at 43,497,185 bp
  • A to G, chromosome 5 at 43,710,542 bp
  • T to A, chromosome 5 at 52,850,542 bp
  • T to C, chromosome 5 at 112,693,298 bp
  • A to T, chromosome 6 at 31,496,746 bp
  • T to A, chromosome 6 at 41,376,938 bp
  • G to T, chromosome 6 at 67,896,345 bp
  • G to A, chromosome 6 at 112,383,937 bp
  • T to C, chromosome 6 at 132,847,370 bp
  • T to C, chromosome 7 at 3,842,071 bp
  • T to A, chromosome 7 at 7,396,655 bp
  • A to G, chromosome 7 at 8,184,332 bp
  • T to C, chromosome 7 at 18,263,057 bp
  • T to C, chromosome 7 at 18,647,368 bp
  • A to T, chromosome 7 at 24,420,630 bp
  • T to C, chromosome 7 at 27,911,164 bp
  • A to T, chromosome 7 at 48,643,674 bp
  • C to A, chromosome 7 at 98,352,497 bp
  • C to A, chromosome 7 at 115,476,983 bp
  • C to A, chromosome 7 at 135,695,635 bp
  • A to T, chromosome 7 at 140,539,125 bp
  • T to A, chromosome 8 at 36,938,240 bp
  • T to A, chromosome 8 at 75,021,838 bp
  • A to G, chromosome 9 at 38,855,958 bp
  • G to A, chromosome 9 at 38,877,854 bp
  • T to A, chromosome 9 at 42,046,552 bp
  • T to A, chromosome 9 at 49,037,824 bp
  • T to C, chromosome 9 at 51,849,011 bp
  • T to C, chromosome 9 at 86,521,247 bp
  • T to C, chromosome 9 at 108,304,134 bp
  • T to A, chromosome 9 at 110,035,117 bp
  • G to T, chromosome 10 at 52,123,237 bp
  • T to C, chromosome 10 at 78,167,489 bp
  • T to C, chromosome 10 at 107,084,922 bp
  • C to T, chromosome 11 at 9,328,138 bp
  • T to G, chromosome 11 at 29,485,888 bp
  • T to G, chromosome 11 at 49,216,065 bp
  • C to A, chromosome 11 at 59,052,616 bp
  • T to C, chromosome 11 at 70,464,239 bp
  • T to A, chromosome 11 at 72,446,250 bp
  • T to C, chromosome 11 at 72,900,673 bp
  • C to T, chromosome 12 at 21,229,248 bp
  • T to A, chromosome 12 at 51,363,494 bp
  • T to C, chromosome 12 at 78,609,239 bp
  • T to A, chromosome 13 at 54,759,959 bp
  • T to C, chromosome 13 at 65,182,935 bp
  • T to C, chromosome 13 at 106,979,035 bp
  • C to A, chromosome 14 at 67,776,300 bp
  • T to C, chromosome 15 at 76,597,328 bp
  • T to C, chromosome 15 at 78,287,915 bp
  • T to G, chromosome 15 at 92,252,397 bp
  • T to A, chromosome 15 at 103,897,594 bp
  • C to T, chromosome 16 at 4,108,071 bp
  • C to T, chromosome 16 at 89,047,719 bp
  • G to A, chromosome 16 at 89,813,006 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • G to T, chromosome 17 at 25,247,036 bp
  • A to T, chromosome 17 at 46,543,251 bp
  • G to T, chromosome 17 at 55,802,189 bp
  • A to C, chromosome 17 at 74,702,318 bp
  • T to C, chromosome 19 at 45,011,710 bp
  • A to G, chromosome 19 at 55,237,974 bp
  • A to T, chromosome 19 at 61,225,159 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8972 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068806-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.