Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9000Btlr/Mmmh
Stock Number:
068831-MU
Citation ID:
RRID:MMRRC_068831-MU
Other Names:
R9000 (G1)
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Prune1
Name: prune exopolyphosphatase
Synonyms: 9230112O05Rik, Prune-M1, Prune
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229589
Homologene: 41429
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 21,487,259 bp
  • C to T, chromosome 1 at 55,697,831 bp
  • T to C, chromosome 1 at 71,314,036 bp
  • C to T, chromosome 1 at 74,522,385 bp
  • T to A, chromosome 1 at 74,561,865 bp
  • T to G, chromosome 2 at 18,872,429 bp
  • T to A, chromosome 2 at 88,624,181 bp
  • A to G, chromosome 2 at 110,624,180 bp
  • A to G, chromosome 2 at 128,634,708 bp
  • A to T, chromosome 2 at 158,636,690 bp
  • A to G, chromosome 3 at 95,255,324 bp
  • T to G, chromosome 4 at 62,208,414 bp
  • G to A, chromosome 5 at 4,055,650 bp
  • A to G, chromosome 5 at 4,756,211 bp
  • T to C, chromosome 5 at 89,706,711 bp
  • T to C, chromosome 6 at 37,097,708 bp
  • G to A, chromosome 6 at 46,484,205 bp
  • A to G, chromosome 7 at 48,199,021 bp
  • A to G, chromosome 7 at 100,416,074 bp
  • T to C, chromosome 7 at 103,732,465 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • GGGG to GGGGCCCAGCTCAGCCACAGGG, chromosome 7 at 126,467,571 bp
  • G to A, chromosome 7 at 127,531,771 bp
  • T to C, chromosome 8 at 3,476,083 bp
  • A to G, chromosome 8 at 13,953,989 bp
  • T to A, chromosome 8 at 24,637,146 bp
  • A to T, chromosome 8 at 24,804,356 bp
  • C to A, chromosome 8 at 45,044,550 bp
  • T to A, chromosome 8 at 69,802,075 bp
  • A to G, chromosome 8 at 104,951,029 bp
  • T to G, chromosome 8 at 121,610,141 bp
  • T to A, chromosome 9 at 15,960,520 bp
  • T to C, chromosome 9 at 16,006,799 bp
  • T to C, chromosome 9 at 30,464,323 bp
  • T to C, chromosome 9 at 119,492,105 bp
  • T to G, chromosome 10 at 50,984,220 bp
  • T to G, chromosome 10 at 50,984,221 bp
  • A to G, chromosome 10 at 60,304,498 bp
  • T to A, chromosome 10 at 86,057,625 bp
  • C to A, chromosome 10 at 88,926,227 bp
  • T to A, chromosome 10 at 88,926,228 bp
  • A to T, chromosome 10 at 127,515,029 bp
  • G to A, chromosome 12 at 29,851,741 bp
  • A to C, chromosome 12 at 110,639,963 bp
  • A to G, chromosome 13 at 32,802,728 bp
  • A to G, chromosome 13 at 41,185,334 bp
  • T to C, chromosome 14 at 64,094,971 bp
  • G to A, chromosome 15 at 81,811,572 bp
  • G to A, chromosome 15 at 96,999,594 bp
  • G to A, chromosome 15 at 99,423,429 bp
  • A to G, chromosome 16 at 11,072,458 bp
  • A to T, chromosome 16 at 97,794,270 bp
  • T to C, chromosome 17 at 20,913,849 bp
  • A to G, chromosome 17 at 22,146,180 bp
  • A to G, chromosome 17 at 24,828,942 bp
  • A to G, chromosome 17 at 49,462,169 bp
  • T to C, chromosome 18 at 36,018,629 bp
  • A to T, chromosome 18 at 61,504,262 bp
  • T to C, chromosome 19 at 55,295,511 bp
  • T to C, chromosome 19 at 58,774,123 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9000 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068831-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.