Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9000Btlr/Mmmh
Stock Number:
068831-MU
Citation ID:
RRID:MMRRC_068831-MU
Other Names:
R9000 (G1)
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Prune1
Name: prune exopolyphosphatase
Synonyms: 9230112O05Rik, Prune-M1, Prune
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229589
Homologene: 41429
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Cnot9
Name: CCR4-NOT transcription complex, subunit 9
Synonyms: FL10, 2610007F23Rik, Rqcd1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 58184
Homologene: 3973
Nckap5l
Name: NCK-associated protein 5-like
Synonyms: C230021P08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380969
Homologene: 18924
Atp13a1
Name: ATPase type 13A1
Synonyms: catp, Cgi152, Atp13a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170759
VEGA: 8
Homologene: 5791
Prdm15
Name: PR domain containing 15
Synonyms: Zfp298, E130018M06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114604
Homologene: 56941
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Syn3
Name: synapsin III
Synonyms: Synapsin IIIa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27204
Homologene: 68320
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Adam18
Name: a disintegrin and metallopeptidase domain 18
Synonyms: Adam27, Dtgn3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13524
HGNC: HGNC:196
Homologene: 74941
Zfp37
Name: zinc finger protein 37
Synonyms: Tzn, Zfp-37
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22696
Homologene: 40682
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Tdrp
Name: testis development related protein
Synonyms: 2610019F03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72148
Homologene: 18348
Wrnip1
Name: Werner helicase interacting protein 1
Synonyms: WHIP, 4833444L21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78903
Homologene: 10592
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf112, nmf181, nmf252, bob, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Plcd4
Name: phospholipase C, delta 4
Synonyms: 4921507K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18802
HGNC: HGNC:9062
Homologene: 88782
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, 9430076A06Rik, D430038H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Slc5a8
Name: solute carrier family 5 (iodide transporter), member 8
Synonyms: SMCT
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216225
VEGA: 10
Homologene: 64832
Slc38a4
Name: solute carrier family 38, member 4
Synonyms: Ata3, 1700012A18Rik, 1110012E16Rik, SNAT4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69354
VEGA: 15
Homologene: 75077
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Fzd1
Name: frizzled class receptor 1
Synonyms: FZ-1, Fz1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14362
HGNC: HGNC:4038
Homologene: 20750
Myt1l
Name: myelin transcription factor 1-like
Synonyms: Png-1, Nztf1, Pmng1, C630034G21Rik, 2900093J19Rik, 2900046C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17933
VEGA: 12
HGNC: HGNC:7623
Homologene: 7435
Plcl1
Name: phospholipase C-like 1
Synonyms: PLC-L, C230017K02Rik, PRIP-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227120
HGNC: HGNC:9063
Homologene: 38155
Zfp947
Name: zinc finger protein 947
Synonyms: Gm4769
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210853
Homologene: 133253
Adam5
Name: a disintegrin and metallopeptidase domain 5
Synonyms: tMDCII
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11499
HGNC: HGNC:212
Homologene: 49138
Pip4k2a
Name: phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Synonyms: Pip5k2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18718
HGNC: HGNC:8997
Homologene: 37995
Snx19
Name: sorting nexin 19
Synonyms: 3526401K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102607
VEGA: 9
Homologene: 8846
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Or52a24
Name: olfactory receptor family 52 subfamily A member 24
Synonyms: GA_x6K02T2PBJ9-6457667-6458617, MOR22-4P, MOR22-1, MOR22-4P, Olfr1526-ps1, Olfr628
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259159
Homologene: 8420
Pnliprp2
Name: pancreatic lipase-related protein 2
Synonyms: PLRP2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18947
VEGA: 19
HGNC: HGNC:9157
Homologene: 3936
Daam2
Name: dishevelled associated activator of morphogenesis 2
Synonyms: 2310016D11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76441
VEGA: 17
Homologene: 69186
Meiob
Name: meiosis specific with OB domains
Synonyms: 4930528F23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75178
VEGA: 17
Homologene: 102013
Nrg2
Name: neuregulin 2
Synonyms: NTAK, Don1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100042150
HGNC: HGNC:7998
Homologene: 75024
Dgki
Name: diacylglycerol kinase, iota
Synonyms: C130010K08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320127
HGNC: HGNC:2855
Homologene: 37956
Prss51
Name: serine protease 51
Synonyms: 1700007N14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504162
Homologene: 131540
Elovl2
Name: ELOVL fatty acid elongase 2
Synonyms: Ssc2, elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54326
Homologene: 23042
Ces2f
Name: carboxylesterase 2F
Synonyms: 2310038E17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71903
HGNC: HGNC:1864
Homologene: 135673
Slc5a12
Name: solute carrier family 5 (sodium/glucose cotransporter), member 12
Synonyms: SMCT2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241612
Homologene: 15107
Actr5
Name: ARP5 actin-related protein 5
Synonyms: B430109J19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109275
Homologene: 6818
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: 9230107O05Rik, D1Mgi1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Arhgef37
Name: Rho guanine nucleotide exchange factor 37
Synonyms: 4933429F08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328967
VEGA: 18
Homologene: 28467
Mrgprb4
Name: MAS-related GPR, member B4
Synonyms: MrgB4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233230
Homologene: 115575
Vmn1r232
Name: vomeronasal 1 receptor 232
Synonyms: V1re4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171227
Homologene: 121611
Ndufa4l2
Name: Ndufa4, mitochondrial complex associated like 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 407790
VEGA: 10
Homologene: 49614
Saxo5
Name: stabilizer of axonemal microtubules 5
Synonyms: 1700019B03Rik, Tex45
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76406
Homologene: 52367
Tef
Name: thyrotroph embryonic factor
Synonyms: 2310028D20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21685
Homologene: 31140
Snn
Name: stannin
Synonyms: 2810407J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20621
VEGA: 16
Homologene: 81710
Or4p4b-ps1
Name: olfactory receptor family 4 subfamily P member 4B, pseudogene 1
Synonyms: GA_x6K02T2PRF0-25008-25939, MOR225-17_p, Olfr475-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404395
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 21,487,259 bp
  • C to T, chromosome 1 at 55,697,831 bp
  • T to C, chromosome 1 at 71,314,036 bp
  • C to T, chromosome 1 at 74,522,385 bp
  • T to A, chromosome 1 at 74,561,865 bp
  • T to G, chromosome 2 at 18,872,429 bp
  • T to A, chromosome 2 at 88,624,181 bp
  • A to G, chromosome 2 at 110,624,180 bp
  • A to G, chromosome 2 at 128,634,708 bp
  • A to T, chromosome 2 at 158,636,690 bp
  • A to G, chromosome 3 at 95,255,324 bp
  • T to G, chromosome 4 at 62,208,414 bp
  • G to A, chromosome 5 at 4,055,650 bp
  • A to G, chromosome 5 at 4,756,211 bp
  • T to C, chromosome 5 at 89,706,711 bp
  • T to C, chromosome 6 at 37,097,708 bp
  • G to A, chromosome 6 at 46,484,205 bp
  • A to G, chromosome 7 at 48,199,021 bp
  • A to G, chromosome 7 at 100,416,074 bp
  • T to C, chromosome 7 at 103,732,465 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • GGGG to GGGGCCCAGCTCAGCCACAGGG, chromosome 7 at 126,467,571 bp
  • G to A, chromosome 7 at 127,531,771 bp
  • T to C, chromosome 8 at 3,476,083 bp
  • A to G, chromosome 8 at 13,953,989 bp
  • T to A, chromosome 8 at 24,637,146 bp
  • A to T, chromosome 8 at 24,804,356 bp
  • C to A, chromosome 8 at 45,044,550 bp
  • T to A, chromosome 8 at 69,802,075 bp
  • A to G, chromosome 8 at 104,951,029 bp
  • T to G, chromosome 8 at 121,610,141 bp
  • T to A, chromosome 9 at 15,960,520 bp
  • T to C, chromosome 9 at 16,006,799 bp
  • T to C, chromosome 9 at 30,464,323 bp
  • T to C, chromosome 9 at 119,492,105 bp
  • T to G, chromosome 10 at 50,984,220 bp
  • T to G, chromosome 10 at 50,984,221 bp
  • A to G, chromosome 10 at 60,304,498 bp
  • T to A, chromosome 10 at 86,057,625 bp
  • C to A, chromosome 10 at 88,926,227 bp
  • T to A, chromosome 10 at 88,926,228 bp
  • A to T, chromosome 10 at 127,515,029 bp
  • G to A, chromosome 12 at 29,851,741 bp
  • A to C, chromosome 12 at 110,639,963 bp
  • A to G, chromosome 13 at 32,802,728 bp
  • A to G, chromosome 13 at 41,185,334 bp
  • T to C, chromosome 14 at 64,094,971 bp
  • G to A, chromosome 15 at 81,811,572 bp
  • G to A, chromosome 15 at 96,999,594 bp
  • G to A, chromosome 15 at 99,423,429 bp
  • A to G, chromosome 16 at 11,072,458 bp
  • A to T, chromosome 16 at 97,794,270 bp
  • T to C, chromosome 17 at 20,913,849 bp
  • A to G, chromosome 17 at 22,146,180 bp
  • A to G, chromosome 17 at 24,828,942 bp
  • A to G, chromosome 17 at 49,462,169 bp
  • T to C, chromosome 18 at 36,018,629 bp
  • A to T, chromosome 18 at 61,504,262 bp
  • T to C, chromosome 19 at 55,295,511 bp
  • T to C, chromosome 19 at 58,774,123 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9000 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068831-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.