Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9009Btlr/Mmmh
Stock Number:
068839-MU
Citation ID:
RRID:MMRRC_068839-MU
Other Names:
R9009 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Cnmd
Name: chondromodulin
Synonyms: Chondromodulin 1, ChM-I, Bricd3, Chmd, Lect1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16840
Homologene: 5095
Prkcd
Name: protein kinase C, delta
Synonyms: PKCdelta, PKC[d], Pkcd, D14Ertd420e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18753
HGNC: HGNC:9399
Homologene: 55963
Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Mtmr7
Name: myotubularin related protein 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54384
HGNC: HGNC:7454
Homologene: 99732
Birc2
Name: baculoviral IAP repeat-containing 2
Synonyms: mcIAP1, MIAP1, IAP1, MIHB, Api1, cIAP1, cIAP-1, HIAP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11797
HGNC: HGNC:590
Homologene: 900
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 46,223,072 bp
  • C to T, chromosome 1 at 53,063,972 bp
  • C to A, chromosome 1 at 91,552,483 bp
  • T to G, chromosome 1 at 91,552,484 bp
  • A to C, chromosome 1 at 163,868,722 bp
  • T to C, chromosome 1 at 173,727,816 bp
  • C to T, chromosome 1 at 179,753,606 bp
  • T to C, chromosome 2 at 18,162,352 bp
  • A to T, chromosome 2 at 21,576,949 bp
  • T to C, chromosome 2 at 66,508,583 bp
  • T to A, chromosome 2 at 72,483,929 bp
  • T to A, chromosome 2 at 104,410,176 bp
  • T to C, chromosome 3 at 96,187,093 bp
  • T to C, chromosome 3 at 126,934,376 bp
  • T to A, chromosome 3 at 133,487,599 bp
  • T to C, chromosome 3 at 137,419,014 bp
  • A to T, chromosome 4 at 41,729,925 bp
  • C to T, chromosome 4 at 115,610,605 bp
  • C to A, chromosome 5 at 83,284,274 bp
  • C to T, chromosome 5 at 105,280,108 bp
  • A to G, chromosome 5 at 136,150,576 bp
  • T to A, chromosome 6 at 23,001,654 bp
  • C to A, chromosome 6 at 48,765,160 bp
  • T to C, chromosome 6 at 89,893,689 bp
  • T to A, chromosome 6 at 132,856,000 bp
  • G to A, chromosome 7 at 6,474,400 bp
  • T to C, chromosome 7 at 22,871,702 bp
  • A to T, chromosome 7 at 45,524,625 bp
  • T to C, chromosome 7 at 73,490,654 bp
  • T to C, chromosome 7 at 73,493,444 bp
  • T to C, chromosome 7 at 78,843,236 bp
  • T to A, chromosome 7 at 102,604,435 bp
  • A to G, chromosome 7 at 141,637,105 bp
  • T to C, chromosome 8 at 35,589,955 bp
  • T to C, chromosome 8 at 40,555,863 bp
  • C to T, chromosome 8 at 48,111,677 bp
  • T to A, chromosome 8 at 120,151,540 bp
  • A to T, chromosome 9 at 7,833,936 bp
  • T to C, chromosome 9 at 106,077,205 bp
  • T to C, chromosome 10 at 22,817,772 bp
  • T to C, chromosome 10 at 44,447,001 bp
  • T to A, chromosome 11 at 8,931,552 bp
  • A to G, chromosome 11 at 50,182,496 bp
  • A to T, chromosome 11 at 58,831,454 bp
  • A to G, chromosome 11 at 94,996,641 bp
  • A to T, chromosome 12 at 57,697,433 bp
  • T to A, chromosome 13 at 27,666,011 bp
  • T to C, chromosome 13 at 61,196,447 bp
  • C to T, chromosome 14 at 30,607,340 bp
  • T to A, chromosome 14 at 79,656,645 bp
  • C to A, chromosome 14 at 117,186,805 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • A to T, chromosome 15 at 9,157,224 bp
  • A to G, chromosome 15 at 58,182,962 bp
  • T to A, chromosome 16 at 97,038,916 bp
  • T to A, chromosome 17 at 26,782,616 bp
  • C to A, chromosome 17 at 33,604,688 bp
  • T to C, chromosome 17 at 42,805,244 bp
  • A to T, chromosome 17 at 66,689,359 bp
  • A to T, chromosome 17 at 84,451,775 bp
  • C to A, chromosome 17 at 87,031,047 bp
  • T to A, chromosome 18 at 25,168,720 bp
  • A to T, chromosome 18 at 37,708,825 bp
  • A to G, chromosome 18 at 65,444,840 bp
  • G to T, chromosome 19 at 7,637,458 bp
  • T to C, chromosome 19 at 45,812,195 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9009 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068839-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.