Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9010Btlr/Mmmh
Stock Number:
068840-MU
Citation ID:
RRID:MMRRC_068840-MU
Other Names:
R9010 (G1)
Major Collection:

Strain Information

Kifc2
Name: kinesin family member C2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16581
VEGA: 15
Homologene: 7800
Itch
Name: itchy, E3 ubiquitin protein ligase
Synonyms: 6720481N21Rik, C230047C07Rik, 8030492O04Rik, AIP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16396
Homologene: 88442
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: RAB5 effector protein, neurocrescin, rabaptin-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
Zfp273
Name: zinc finger protein 273
Synonyms: 6820416H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212569
Homologene: 133729
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Tdh
Name: L-threonine dehydrogenase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58865
Homologene: 10987
Washc2
Name: WASH complex subunit 2
Synonyms: C530005J20Rik, D6Wsu116e, Fam21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28006
Homologene: 41686
Cabin1
Name: calcineurin binding protein 1
Synonyms: Ppp3in, Cain, A330070M20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104248
VEGA: 10
Homologene: 49307
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Rbbp4
Name: retinoblastoma binding protein 4, chromatin remodeling factor
Synonyms: CAF-1 p48 subunit, RBAP48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19646
HGNC: HGNC:9887
Homologene: 21153
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Nusap1
Name: nucleolar and spindle associated protein 1
Synonyms: NuSAP, 2610201A12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108907
Homologene: 10207
Naa16
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms: 1300019C06Rik, Narg1l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66897
Homologene: 134838
Rims2
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, 2810036I15Rik, Syt3-rs
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Rassf3
Name: Ras association (RalGDS/AF-6) domain family member 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192678
VEGA: 10
Homologene: 16365
Lefty2
Name: left-right determination factor 2
Synonyms: 6030463A22Rik, Ebaf, Leftb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320202
HGNC: HGNC:3122
Homologene: 2434
Thbs1
Name: thrombospondin 1
Synonyms: TSP1, TSP-1, Thbs-1, tbsp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21825
Homologene: 31142
Ppp4r3a
Name: protein phosphatase 4 regulatory subunit 3A
Synonyms: 1110034C04Rik, Smek1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68734
VEGA: 12
Homologene: 69510
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Plxna2
Name: plexin A2
Synonyms: OCT, Plxn2, 2810428A13Rik, PlexA2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Akap2
Name: A kinase (PRKA) anchor protein 2
Synonyms: B230340M18Rik, AKAP-KL
Type: Gene
Species: Mouse
Chromosome: 4
Entpd3
Name: ectonucleoside triphosphate diphosphohydrolase 3
Synonyms: NTPDase-3, HB6, Cd39l3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215446
HGNC: HGNC:3365
Homologene: 68171
Eif1ad
Name: eukaryotic translation initiation factor 1A domain containing
Synonyms: 2010003J03Rik, Eif1ad1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69860
VEGA: 19
Homologene: 41860
Msh4
Name: mutS homolog 4
Synonyms: mMsh4, 4930485C04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55993
HGNC: HGNC:7327
Homologene: 1830
Cercam
Name: cerebral endothelial cell adhesion molecule
Synonyms: CerCAM, Ceecam1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99151
Homologene: 22954
Tgm5
Name: transglutaminase 5
Synonyms: 2310007C07Rik, TGx
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74176
Homologene: 20899
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Garre1
Name: granule associated Rac and RHOG effector 1
Synonyms: 4931406P16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233103
Homologene: 8795
Or1p1
Name: olfactory receptor family 1 subfamily P member 1
Synonyms: IH3, MOR133-3P, GA_x6K02T2P1NL-4434429-4435400, Olfr59
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18359
HGNC: HGNC:8222
Homologene: 73924
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Gm19410
Name: predicted gene, 19410
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502846
Homologene: 132117
Rabgap1l
Name: RAB GTPase activating protein 1-like
Synonyms: Hh1, 9630005B12Rik, 5830411O09Rik, 8430421H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 29809
Homologene: 8143
Cgnl1
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68178
Homologene: 41901
Clec2g
Name: C-type lectin domain family 2, member g
Synonyms: 4632413B12Rik, Ocilrp1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70809
Homologene: 136309
Gpat2
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: Gpat2, A530057A03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215456
Homologene: 19037
Mkrn2
Name: makorin, ring finger protein, 2
Synonyms: 2610002L04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67027
HGNC: HGNC:7113
Homologene: 8392
Or2w6
Name: olfactory receptor family 2 subfamily W member 6
Synonyms: GA_x6K02T2QHY8-11577590-11578528, MOR256-12, Olfr1361
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258534
Homologene: 88362
Padi2
Name: peptidyl arginine deiminase, type II
Synonyms: PAD type II, Pdi, Pdi2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18600
Homologene: 7214
Ntn4
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57764
Homologene: 10934
Tmprss9
Name: transmembrane protease, serine 9
Synonyms: Serase-1B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432478
VEGA: 10
Homologene: 115302
Bst1
Name: bone marrow stromal cell antigen 1
Synonyms: 114/A10, Ly65, Bp3, Bsta1, CD157
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12182
HGNC: HGNC:1118
Homologene: 3198
Cckar
Name: cholecystokinin A receptor
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12425
HGNC: HGNC:1570
Homologene: 37337
Rad51ap2
Name: RAD51 associated protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209550
VEGA: 12
Homologene: 85245
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242248
Homologene: 9926
Prelid2
Name: PRELI domain containing 2
Synonyms: 1700003A01Rik, C330008K14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 77619
VEGA: 18
Homologene: 45749
Zfp395
Name: zinc finger protein 395
Synonyms: LOC380912, BC027382
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380912
VEGA: 14
Homologene: 10255
Or4e2
Name: olfactory receptor family 4 subfamily E member 2
Synonyms: GA_x6K02T2RJGY-534312-533386, MOR244-3, MOR83, Olfr1509
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57271
HGNC: HGNC:8297
Homologene: 41378
Vmn2r117
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619788
Homologene: 86604
Vmn1r72
Name: vomeronasal 1 receptor 72
Synonyms: V1rg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252905
Homologene: 74318
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Apol6
Name: apolipoprotein L 6
Synonyms: 2310076O14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71939
Homologene: 49940
Zfp512b
Name: zinc finger protein 512B
Synonyms: LOC269401, Znf512b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269401
Homologene: 69314
Lrrc14b
Name: leucine rich repeat containing 14B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432779
Homologene: 47758
Nab1
Name: Ngfi-A binding protein 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17936
HGNC: HGNC:7626
Homologene: 4352
Angel1
Name: angel homolog 1
Synonyms: 1110030H02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68737
Homologene: 32251
P2ry2
Name: purinergic receptor P2Y, G-protein coupled 2
Synonyms: P2Y2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18442
HGNC: HGNC:8541
Homologene: 1927
Crisp1
Name: cysteine-rich secretory protein 1
Synonyms: CRISP-1, Aeg1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11571
Homologene: 135665
Klk1b16
Name: kallikrein 1-related peptidase b16
Synonyms: mGk-16, Klk16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16615
HGNC: HGNC:6357
Homologene: 68141
Crb2
Name: crumbs family member 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241324
Homologene: 45474
2310003L06Rik
Name: RIKEN cDNA 2310003L06 gene
Type: Gene
Species: Mouse
Chromosome: 5
Ceacam9
Name: CEA cell adhesion molecule 9
Synonyms: mmCGM8, Cea-5, Cea5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26368
Homologene: 74987
Chst13
Name: carbohydrate sulfotransferase 13
Synonyms: Chst13, 1110067M19Rik, C4ST-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71797
Homologene: 44360
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 44,061,473 bp
  • T to A, chromosome 1 at 52,490,451 bp
  • G to A, chromosome 1 at 160,700,873 bp
  • T to A, chromosome 1 at 180,894,607 bp
  • T to C, chromosome 1 at 194,788,909 bp
  • G to A, chromosome 2 at 29,876,059 bp
  • A to G, chromosome 2 at 37,790,686 bp
  • A to C, chromosome 2 at 118,122,564 bp
  • A to G, chromosome 2 at 119,648,975 bp
  • T to C, chromosome 2 at 121,048,890 bp
  • A to G, chromosome 2 at 127,435,226 bp
  • A to T, chromosome 2 at 155,179,071 bp
  • G to A, chromosome 2 at 166,859,364 bp
  • G to A, chromosome 2 at 181,588,218 bp
  • A to T, chromosome 3 at 136,055,798 bp
  • T to C, chromosome 3 at 153,890,182 bp
  • A to T, chromosome 4 at 57,883,192 bp
  • A to C, chromosome 4 at 129,322,387 bp
  • A to G, chromosome 4 at 140,936,613 bp
  • T to C, chromosome 5 at 43,825,353 bp
  • T to A, chromosome 5 at 53,699,821 bp
  • T to A, chromosome 5 at 87,971,645 bp
  • G to T, chromosome 5 at 93,268,757 bp
  • T to A, chromosome 5 at 144,846,416 bp
  • G to A, chromosome 6 at 90,309,524 bp
  • T to A, chromosome 6 at 115,614,622 bp
  • G to A, chromosome 6 at 116,221,862 bp
  • T to A, chromosome 6 at 128,948,725 bp
  • A to T, chromosome 7 at 11,670,218 bp
  • T to C, chromosome 7 at 16,721,991 bp
  • A to T, chromosome 7 at 34,239,066 bp
  • A to T, chromosome 7 at 44,140,753 bp
  • A to G, chromosome 7 at 46,300,470 bp
  • A to C, chromosome 7 at 100,998,151 bp
  • C to T, chromosome 7 at 139,927,795 bp
  • T to C, chromosome 7 at 141,640,084 bp
  • A to G, chromosome 8 at 35,814,857 bp
  • A to T, chromosome 9 at 71,651,349 bp
  • T to C, chromosome 9 at 120,555,759 bp
  • C to A, chromosome 10 at 75,735,058 bp
  • C to A, chromosome 10 at 80,897,867 bp
  • T to A, chromosome 10 at 92,899,059 bp
  • T to C, chromosome 10 at 93,644,644 bp
  • C to A, chromosome 10 at 121,476,086 bp
  • G to A, chromosome 11 at 70,919,208 bp
  • G to T, chromosome 11 at 74,289,479 bp
  • A to T, chromosome 11 at 107,073,750 bp
  • G to T, chromosome 12 at 11,458,674 bp
  • T to C, chromosome 12 at 86,723,379 bp
  • T to C, chromosome 12 at 101,058,332 bp
  • A to T, chromosome 12 at 114,487,329 bp
  • A to G, chromosome 13 at 21,658,511 bp
  • A to T, chromosome 13 at 67,826,058 bp
  • A to G, chromosome 13 at 74,361,032 bp
  • T to A, chromosome 14 at 52,451,099 bp
  • C to T, chromosome 14 at 63,500,255 bp
  • A to G, chromosome 14 at 65,386,499 bp
  • T to G, chromosome 14 at 79,370,042 bp
  • T to A, chromosome 15 at 39,452,390 bp
  • A to G, chromosome 15 at 76,666,685 bp
  • A to G, chromosome 15 at 77,051,497 bp
  • G to A, chromosome 16 at 11,631,527 bp
  • G to A, chromosome 16 at 59,554,339 bp
  • A to G, chromosome 17 at 23,460,471 bp
  • C to A, chromosome 17 at 34,064,786 bp
  • A to T, chromosome 17 at 40,305,210 bp
  • A to T, chromosome 17 at 58,364,164 bp
  • C to A, chromosome 17 at 78,773,710 bp
  • A to T, chromosome 18 at 41,932,716 bp
  • T to A, chromosome 19 at 5,368,698 bp
  • T to A, chromosome 19 at 41,883,490 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9010 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068840-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.