Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9010Btlr/Mmmh
Stock Number:
068840-MU
Citation ID:
RRID:MMRRC_068840-MU
Other Names:
R9010 (G1)
Major Collection:

Strain Information

Kifc2
Name: kinesin family member C2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16581
VEGA: 15
Homologene: 7800
Itch
Name: itchy, E3 ubiquitin protein ligase
Synonyms: 6720481N21Rik, C230047C07Rik, 8030492O04Rik, AIP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16396
Homologene: 88442
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: RAB5 effector protein, neurocrescin, rabaptin-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
Zfp273
Name: zinc finger protein 273
Synonyms: 6820416H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212569
Homologene: 133729
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 44,061,473 bp
  • T to A, chromosome 1 at 52,490,451 bp
  • G to A, chromosome 1 at 160,700,873 bp
  • T to A, chromosome 1 at 180,894,607 bp
  • T to C, chromosome 1 at 194,788,909 bp
  • G to A, chromosome 2 at 29,876,059 bp
  • A to G, chromosome 2 at 37,790,686 bp
  • A to C, chromosome 2 at 118,122,564 bp
  • A to G, chromosome 2 at 119,648,975 bp
  • T to C, chromosome 2 at 121,048,890 bp
  • A to G, chromosome 2 at 127,435,226 bp
  • A to T, chromosome 2 at 155,179,071 bp
  • G to A, chromosome 2 at 166,859,364 bp
  • G to A, chromosome 2 at 181,588,218 bp
  • A to T, chromosome 3 at 136,055,798 bp
  • T to C, chromosome 3 at 153,890,182 bp
  • A to T, chromosome 4 at 57,883,192 bp
  • A to C, chromosome 4 at 129,322,387 bp
  • A to G, chromosome 4 at 140,936,613 bp
  • T to C, chromosome 5 at 43,825,353 bp
  • T to A, chromosome 5 at 53,699,821 bp
  • T to A, chromosome 5 at 87,971,645 bp
  • G to T, chromosome 5 at 93,268,757 bp
  • T to A, chromosome 5 at 144,846,416 bp
  • G to A, chromosome 6 at 90,309,524 bp
  • T to A, chromosome 6 at 115,614,622 bp
  • G to A, chromosome 6 at 116,221,862 bp
  • T to A, chromosome 6 at 128,948,725 bp
  • A to T, chromosome 7 at 11,670,218 bp
  • T to C, chromosome 7 at 16,721,991 bp
  • A to T, chromosome 7 at 34,239,066 bp
  • A to T, chromosome 7 at 44,140,753 bp
  • A to G, chromosome 7 at 46,300,470 bp
  • A to C, chromosome 7 at 100,998,151 bp
  • C to T, chromosome 7 at 139,927,795 bp
  • T to C, chromosome 7 at 141,640,084 bp
  • A to G, chromosome 8 at 35,814,857 bp
  • A to T, chromosome 9 at 71,651,349 bp
  • T to C, chromosome 9 at 120,555,759 bp
  • C to A, chromosome 10 at 75,735,058 bp
  • C to A, chromosome 10 at 80,897,867 bp
  • T to A, chromosome 10 at 92,899,059 bp
  • T to C, chromosome 10 at 93,644,644 bp
  • C to A, chromosome 10 at 121,476,086 bp
  • G to A, chromosome 11 at 70,919,208 bp
  • G to T, chromosome 11 at 74,289,479 bp
  • A to T, chromosome 11 at 107,073,750 bp
  • G to T, chromosome 12 at 11,458,674 bp
  • T to C, chromosome 12 at 86,723,379 bp
  • T to C, chromosome 12 at 101,058,332 bp
  • A to T, chromosome 12 at 114,487,329 bp
  • A to G, chromosome 13 at 21,658,511 bp
  • A to T, chromosome 13 at 67,826,058 bp
  • A to G, chromosome 13 at 74,361,032 bp
  • T to A, chromosome 14 at 52,451,099 bp
  • C to T, chromosome 14 at 63,500,255 bp
  • A to G, chromosome 14 at 65,386,499 bp
  • T to G, chromosome 14 at 79,370,042 bp
  • T to A, chromosome 15 at 39,452,390 bp
  • A to G, chromosome 15 at 76,666,685 bp
  • A to G, chromosome 15 at 77,051,497 bp
  • G to A, chromosome 16 at 11,631,527 bp
  • G to A, chromosome 16 at 59,554,339 bp
  • A to G, chromosome 17 at 23,460,471 bp
  • C to A, chromosome 17 at 34,064,786 bp
  • A to T, chromosome 17 at 40,305,210 bp
  • A to T, chromosome 17 at 58,364,164 bp
  • C to A, chromosome 17 at 78,773,710 bp
  • A to T, chromosome 18 at 41,932,716 bp
  • T to A, chromosome 19 at 5,368,698 bp
  • T to A, chromosome 19 at 41,883,490 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9010 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068840-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.