Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9018Btlr/Mmmh
Stock Number:
068848-MU
Citation ID:
RRID:MMRRC_068848-MU
Other Names:
R9018 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: C78091, Unrip
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Slc12a6
Name: solute carrier family 12, member 6
Synonyms: KCC3, gaxp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 6,249,266 bp
  • A to G, chromosome 1 at 34,196,059 bp
  • T to A, chromosome 1 at 164,053,679 bp
  • C to T, chromosome 1 at 167,308,563 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • C to A, chromosome 2 at 5,844,872 bp
  • C to T, chromosome 2 at 52,434,694 bp
  • C to T, chromosome 2 at 52,716,451 bp
  • A to G, chromosome 2 at 112,344,240 bp
  • A to G, chromosome 2 at 164,852,490 bp
  • T to A, chromosome 3 at 19,989,152 bp
  • T to A, chromosome 3 at 41,609,857 bp
  • G to A, chromosome 3 at 69,739,995 bp
  • G to A, chromosome 4 at 8,847,083 bp
  • A to G, chromosome 4 at 120,505,317 bp
  • A to G, chromosome 4 at 130,013,866 bp
  • G to C, chromosome 4 at 152,039,461 bp
  • A to G, chromosome 5 at 29,434,714 bp
  • T to A, chromosome 5 at 110,289,809 bp
  • A to G, chromosome 5 at 124,298,650 bp
  • T to A, chromosome 6 at 17,906,495 bp
  • C to T, chromosome 6 at 55,301,087 bp
  • C to T, chromosome 6 at 124,745,698 bp
  • A to G, chromosome 6 at 137,739,813 bp
  • C to A, chromosome 7 at 43,584,065 bp
  • C to T, chromosome 7 at 102,411,275 bp
  • A to T, chromosome 7 at 120,289,540 bp
  • A to G, chromosome 7 at 120,319,309 bp
  • A to T, chromosome 7 at 127,879,071 bp
  • A to G, chromosome 7 at 140,944,666 bp
  • A to T, chromosome 7 at 141,168,631 bp
  • A to G, chromosome 8 at 3,642,627 bp
  • G to A, chromosome 8 at 23,116,248 bp
  • A to T, chromosome 8 at 24,694,276 bp
  • A to C, chromosome 8 at 33,615,759 bp
  • A to G, chromosome 8 at 80,704,726 bp
  • G to C, chromosome 8 at 87,781,753 bp
  • A to G, chromosome 8 at 122,895,512 bp
  • C to T, chromosome 9 at 37,404,224 bp
  • T to A, chromosome 9 at 38,976,391 bp
  • T to A, chromosome 9 at 61,412,468 bp
  • A to T, chromosome 9 at 80,251,804 bp
  • T to A, chromosome 9 at 80,394,192 bp
  • T to A, chromosome 9 at 106,865,637 bp
  • T to C, chromosome 9 at 108,117,289 bp
  • T to G, chromosome 10 at 7,761,276 bp
  • T to A, chromosome 10 at 33,779,693 bp
  • A to T, chromosome 10 at 56,072,597 bp
  • G to A, chromosome 10 at 75,893,770 bp
  • A to G, chromosome 10 at 76,166,712 bp
  • A to G, chromosome 10 at 79,396,705 bp
  • A to G, chromosome 10 at 79,480,186 bp
  • G to A, chromosome 10 at 79,548,440 bp
  • T to C, chromosome 10 at 118,860,109 bp
  • G to A, chromosome 11 at 51,048,111 bp
  • C to T, chromosome 11 at 72,443,594 bp
  • C to T, chromosome 11 at 78,023,684 bp
  • C to A, chromosome 11 at 85,337,135 bp
  • A to G, chromosome 12 at 4,658,091 bp
  • T to A, chromosome 12 at 72,556,663 bp
  • G to A, chromosome 12 at 112,939,286 bp
  • A to G, chromosome 12 at 117,748,397 bp
  • A to G, chromosome 12 at 119,446,206 bp
  • A to T, chromosome 14 at 55,720,423 bp
  • A to C, chromosome 14 at 57,438,245 bp
  • G to A, chromosome 14 at 70,707,424 bp
  • A to T, chromosome 15 at 66,449,630 bp
  • T to C, chromosome 15 at 85,242,014 bp
  • G to A, chromosome 15 at 99,279,735 bp
  • A to G, chromosome 16 at 10,446,982 bp
  • T to C, chromosome 16 at 18,066,743 bp
  • T to C, chromosome 16 at 32,762,536 bp
  • A to C, chromosome 16 at 95,296,270 bp
  • C to T, chromosome 17 at 28,777,786 bp
  • T to A, chromosome 17 at 55,791,993 bp
  • T to A, chromosome 18 at 10,542,004 bp
  • A to T, chromosome 19 at 13,471,357 bp
  • A to G, chromosome 19 at 25,673,621 bp
  • C to T, chromosome X at 142,237,751 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9018 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068848-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.