Strain Name:
C57BL/6J-MtgxR9018Btlr/Mmmh
Stock Number:
068848-MU
Citation ID:
RRID:MMRRC_068848-MU
Other Names:
R9018 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: Unrip, C78091
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Slc12a6
Name: solute carrier family 12, member 6
Synonyms: gaxp, KCC3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: Cyn, Gena 52, Whi, Todo, Obt, WBE1, Mt, A730019I05Rik, Lda, Flo, GENA 47, Edy, GENA 60, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Atn1
Name: atrophin 1
Synonyms: atrophin-1, Drpla, Atr1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Dst
Name: dystonin
Synonyms: Bpag, Macf2, A830042E19Rik, nmf339, 2310001O04Rik, BPAG1, BPAG1-n, bullous pemphigoid antigen 1, bullous pemphigoid antigen 1, athetoid, nmf203, Bpag1, ah
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Zfp423
Name: zinc finger protein 423
Synonyms: Ebfaz, ataxia1, Zfp104, Roaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Jade1
Name: jade family PHD finger 1
Synonyms: D530048A03Rik, Phf17
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269424
Homologene: 18162
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 5730456G07Rik, 1200004O12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Katna1
Name: katanin p60 (ATPase-containing) subunit A1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23924
HGNC: HGNC:6216
Homologene: 56014
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 9530048I21Rik, 3010027A04Rik, 2410104C19Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Nol9
Name: nucleolar protein 9
Synonyms: 6030462G04Rik, 4632412I24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74035
Homologene: 32589
Xpo7
Name: exportin 7
Synonyms: Ranbp16, 4930506C02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Zfp719
Name: zinc finger protein 719
Synonyms: C630016O21Rik, mszf6, 9430094P17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210105
St7
Name: suppression of tumorigenicity 7
Synonyms: HELG, 9430001H04Rik, SEN4, RAY1, TSG7, Fam4a2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70427
Homologene: 18941
Adgrb2
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230775
HGNC: HGNC:944
Homologene: 1288
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Mybbp1a
Name: MYB binding protein (P160) 1a
Synonyms: p67MBP, p160MBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18432
HGNC: HGNC:7546
Homologene: 40954
Tle3
Name: transducin-like enhancer of split 3
Synonyms: 2610103N05Rik, ESG, Grg3a, Grg3b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21887
Homologene: 21059
Stim1
Name: stromal interaction molecule 1
Synonyms: SIM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20866
Homologene: 20681
Pex19
Name: peroxisomal biogenesis factor 19
Synonyms: Pxf, peroxisome biogenesis factor 19
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19298
HGNC: HGNC:9713
Homologene: 134253
Itsn2
Name: intersectin 2
Synonyms: Ese2, Sh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Sh3p18
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Scmh1
Name: sex comb on midleg homolog 1
Synonyms: Scml3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29871
Homologene: 32146
Tmco1
Name: transmembrane and coiled-coil domains 1
Synonyms: 4930403O06Rik, 1190006A08Rik, ESTM39
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68944
Homologene: 10384
Cdc123
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98828
Homologene: 4394
Nmd3
Name: NMD3 ribosome export adaptor
Synonyms: C87860
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 97112
Homologene: 6127
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: C6orf170, b2b2284Clo, Bromi, D630037F22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Mphosph9
Name: M-phase phosphoprotein 9
Synonyms: MPP9, 4930548D04Rik, 9630025B04Rik, MPP-9, B930097C17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269702
HGNC: HGNC:7215
Homologene: 11256
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Stxbp2
Name: syntaxin binding protein 2
Synonyms: Munc-18b, Munc18b, C79054, muSec1, Munc-18-2, Sxtp2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20911
Homologene: 55530
Myo6
Name: myosin VI
Synonyms: Tlc, Myo6rsv, rsv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17920
HGNC: HGNC:7605
Homologene: 56417
Ppp2cb
Name: protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
Synonyms: D8Ertd766e, PP2Ac
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19053
HGNC: HGNC:9300
Homologene: 37889
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Sult3a2
Name: sulfotransferase family 3A, member 2
Synonyms: Gm4794
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215895
VEGA: 10
Homologene: 111031
Pcnx4
Name: pecanex homolog 4
Synonyms: Pcnxl4, 1810048J11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67708
VEGA: 12
Homologene: 23366
Zfp646
Name: zinc finger protein 646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233905
Homologene: 8802
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: Fip200, 2900055E04Rik, Cc1, LaXp180, 5930404L04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Impg1
Name: interphotoreceptor matrix proteoglycan 1
Synonyms: IMP150, A930015H12Rik, SPACR
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 63859
HGNC: HGNC:6055
Homologene: 1201
Rapgef5
Name: Rap guanine nucleotide exchange factor (GEF) 5
Synonyms: mr-gef, D030051B22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217944
VEGA: 12
Homologene: 56563
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Slc5a4a
Name: solute carrier family 5, member 4a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64452
VEGA: 10
Rnh1
Name: ribonuclease/angiogenin inhibitor 1
Synonyms: RNH
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 107702
Homologene: 2204
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Adgre4
Name: adhesion G protein-coupled receptor E4
Synonyms: D17Ertd479e, EGF-TM7, Emr4, FIRE, Gpr127
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52614
VEGA: 17
Homologene: 64640
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Dnaaf11
Name: dynein axonemal assembly factor 11
Synonyms: LRTP, Lrrc6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54562
Homologene: 34534
Vmn2r83
Name: vomeronasal 2, receptor 83
Synonyms: EG625029
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625029
Homologene: 83669
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 4930539G24Rik, 1700110B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Ppm1d
Name: protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms: Wip1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53892
HGNC: HGNC:9277
Homologene: 31185
Dmrt2
Name: doublesex and mab-3 related transcription factor 2
Synonyms: Terra
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226049
VEGA: 19
HGNC: HGNC:2935
Homologene: 17111
Or5b118
Name: olfactory receptor family 5 subfamily B member 118
Synonyms: Olfr1474, MOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258123
Homologene: 79417
Or8d1b
Name: olfactory receptor family 8 subfamily D member 1B
Synonyms: GA_x6K02T2PVTD-32671531-32672457, Olfr933, MOR171-22
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258433
VEGA: 9
HGNC: HGNC:8481
Homologene: 79676
Smarca5
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms: Snf2h, D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93762
Homologene: 55764
Or1x6
Name: olfactory receptor family 1 subfamily X member 6
Synonyms: Olfr1375, MOR126-2, GA_x6K02T2QP88-4389999-4389056, Olfr1375-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258509
Nudt14
Name: nudix hydrolase 14
Synonyms: 1110030M18Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 14
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66174
VEGA: 12
Homologene: 11930
Rabggta
Name: Rab geranylgeranyl transferase, a subunit
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56187
VEGA: 14
HGNC: HGNC:9795
Homologene: 32443
Pltp
Name: phospholipid transfer protein
Synonyms: OD107, Bpife
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18830
HGNC: HGNC:9093
Homologene: 4536
Pgghg
Name: protein glucosylgalactosylhydroxylysine glucosidase
Synonyms: 5730511L01Rik, Athl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212974
Homologene: 16023
Mindy4
Name: MINDY lysine 48 deubiquitinase 4
Synonyms: C330043M08Rik, LOC384387, Fam188b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330323
Homologene: 49991
Ift88
Name: intraflagellar transport 88
Synonyms: orpk, TgN737Rpw, polaris, IFT88, Tg737Rpw, Tg737, Oak Ridge polycystic kidneys, fxo, Ttc10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21821
Homologene: 4761
Sele
Name: selectin, endothelial cell
Synonyms: E-selectin, Elam, CD62E
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20339
Homologene: 389
Dyrk2
Name: dual-specificity tyrosine phosphorylation regulated kinase 2
Synonyms: 1810038L18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69181
VEGA: 10
HGNC: HGNC:3093
Homologene: 48437
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Mapk13
Name: mitogen-activated protein kinase 13
Synonyms: SAPK4, p38 delta MAP kinase, Serk4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26415
HGNC: HGNC:6875
Homologene: 48133
Adam3
Name: ADAM metallopeptidase domain 3
Synonyms: ADAM3, tMDC, Cyrn1, Taz83, Taz83
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11497
HGNC: HGNC:209
Homologene: 69052
Nom1
Name: nucleolar protein with MIF4G domain 1
Synonyms: D5Kng1, Gm1040, LOC381627
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433864
Homologene: 39776
Derl3
Name: Der1-like domain family, member 3
Synonyms: derlin-3, 1810006I20Rik, 1810063P04Rik, IZP6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70377
VEGA: 10
Homologene: 41566
Cacnb4
Name: calcium channel, voltage-dependent, beta 4 subunit
Synonyms: 3110038O15Rik, Cchb4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12298
HGNC: HGNC:1404
Homologene: 20188
Kcnj15
Name: potassium inwardly-rectifying channel, subfamily J, member 15
Synonyms: 4930414N08Rik, Kir4.2, IRKK
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16516
HGNC: HGNC:6261
Homologene: 1690
Tvp23a
Name: trans-golgi network vesicle protein 23A
Synonyms: Fam18a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 383103
Homologene: 19919
Dgcr6
Name: DiGeorge syndrome critical region gene 6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13353
Homologene: 4152
Nxt2
Name: nuclear transport factor 2-like export factor 2
Synonyms: P15-2, 6330587F24Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 237082
Homologene: 10273
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 6,249,266 bp
  • A to G, chromosome 1 at 34,196,059 bp
  • T to A, chromosome 1 at 164,053,679 bp
  • C to T, chromosome 1 at 167,308,563 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • C to A, chromosome 2 at 5,844,872 bp
  • C to T, chromosome 2 at 52,434,694 bp
  • C to T, chromosome 2 at 52,716,451 bp
  • A to G, chromosome 2 at 112,344,240 bp
  • A to G, chromosome 2 at 164,852,490 bp
  • T to A, chromosome 3 at 19,989,152 bp
  • T to A, chromosome 3 at 41,609,857 bp
  • G to A, chromosome 3 at 69,739,995 bp
  • G to A, chromosome 4 at 8,847,083 bp
  • A to G, chromosome 4 at 120,505,317 bp
  • A to G, chromosome 4 at 130,013,866 bp
  • G to C, chromosome 4 at 152,039,461 bp
  • A to G, chromosome 5 at 29,434,714 bp
  • T to A, chromosome 5 at 110,289,809 bp
  • A to G, chromosome 5 at 124,298,650 bp
  • T to A, chromosome 6 at 17,906,495 bp
  • C to T, chromosome 6 at 55,301,087 bp
  • C to T, chromosome 6 at 124,745,698 bp
  • A to G, chromosome 6 at 137,739,813 bp
  • C to A, chromosome 7 at 43,584,065 bp
  • C to T, chromosome 7 at 102,411,275 bp
  • A to T, chromosome 7 at 120,289,540 bp
  • A to G, chromosome 7 at 120,319,309 bp
  • A to T, chromosome 7 at 127,879,071 bp
  • A to G, chromosome 7 at 140,944,666 bp
  • A to T, chromosome 7 at 141,168,631 bp
  • A to G, chromosome 8 at 3,642,627 bp
  • G to A, chromosome 8 at 23,116,248 bp
  • A to T, chromosome 8 at 24,694,276 bp
  • A to C, chromosome 8 at 33,615,759 bp
  • A to G, chromosome 8 at 80,704,726 bp
  • G to C, chromosome 8 at 87,781,753 bp
  • A to G, chromosome 8 at 122,895,512 bp
  • C to T, chromosome 9 at 37,404,224 bp
  • T to A, chromosome 9 at 38,976,391 bp
  • T to A, chromosome 9 at 61,412,468 bp
  • A to T, chromosome 9 at 80,251,804 bp
  • T to A, chromosome 9 at 80,394,192 bp
  • T to A, chromosome 9 at 106,865,637 bp
  • T to C, chromosome 9 at 108,117,289 bp
  • T to G, chromosome 10 at 7,761,276 bp
  • T to A, chromosome 10 at 33,779,693 bp
  • A to T, chromosome 10 at 56,072,597 bp
  • G to A, chromosome 10 at 75,893,770 bp
  • A to G, chromosome 10 at 76,166,712 bp
  • A to G, chromosome 10 at 79,396,705 bp
  • A to G, chromosome 10 at 79,480,186 bp
  • G to A, chromosome 10 at 79,548,440 bp
  • T to C, chromosome 10 at 118,860,109 bp
  • G to A, chromosome 11 at 51,048,111 bp
  • C to T, chromosome 11 at 72,443,594 bp
  • C to T, chromosome 11 at 78,023,684 bp
  • C to A, chromosome 11 at 85,337,135 bp
  • A to G, chromosome 12 at 4,658,091 bp
  • T to A, chromosome 12 at 72,556,663 bp
  • G to A, chromosome 12 at 112,939,286 bp
  • A to G, chromosome 12 at 117,748,397 bp
  • A to G, chromosome 12 at 119,446,206 bp
  • A to T, chromosome 14 at 55,720,423 bp
  • A to C, chromosome 14 at 57,438,245 bp
  • G to A, chromosome 14 at 70,707,424 bp
  • A to T, chromosome 15 at 66,449,630 bp
  • T to C, chromosome 15 at 85,242,014 bp
  • G to A, chromosome 15 at 99,279,735 bp
  • A to G, chromosome 16 at 10,446,982 bp
  • T to C, chromosome 16 at 18,066,743 bp
  • T to C, chromosome 16 at 32,762,536 bp
  • A to C, chromosome 16 at 95,296,270 bp
  • C to T, chromosome 17 at 28,777,786 bp
  • T to A, chromosome 17 at 55,791,993 bp
  • T to A, chromosome 18 at 10,542,004 bp
  • A to T, chromosome 19 at 13,471,357 bp
  • A to G, chromosome 19 at 25,673,621 bp
  • C to T, chromosome X at 142,237,751 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9018 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068848-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.