Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9027Btlr/Mmmh
Stock Number:
068856-MU
Citation ID:
RRID:MMRRC_068856-MU
Other Names:
R9027 (G1)
Major Collection:

Strain Information

Psen2
Name: presenilin 2
Synonyms: ALG-3, PS-2, PS2, Ad4h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19165
HGNC: HGNC:9509
Homologene: 386
Slc12a8
Name: solute carrier family 12 (potassium/chloride transporters), member 8
Synonyms: E330020C02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 171286
Homologene: 11628
Cdk19
Name: cyclin dependent kinase 19
Synonyms: 2700084L06Rik, Cdc2l6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78334
VEGA: 10
Homologene: 22862
Dmtn
Name: dematin actin binding protein
Synonyms: dematin, Epb4.9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13829
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
Arl1
Name: ADP-ribosylation factor-like 1
Synonyms: 2310008D22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104303
HGNC: HGNC:692
Homologene: 20319
Ccz1
Name: CCZ1 vacuolar protein trafficking and biogenesis associated
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231874
Homologene: 56717
Vapb
Name: vesicle-associated membrane protein, associated protein B and C
Synonyms: VAMP-associated protein 33b, VAP33b, D2Abb2e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56491
Homologene: 36163
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 75,388,432 bp
  • A to T, chromosome 1 at 128,368,426 bp
  • T to A, chromosome 1 at 132,611,605 bp
  • C to A, chromosome 1 at 180,229,407 bp
  • A to T, chromosome 1 at 195,151,721 bp
  • A to T, chromosome 2 at 111,692,172 bp
  • A to G, chromosome 2 at 173,776,155 bp
  • G to A, chromosome 3 at 144,912,066 bp
  • G to A, chromosome 4 at 32,996,083 bp
  • A to T, chromosome 4 at 133,210,898 bp
  • C to T, chromosome 5 at 30,232,609 bp
  • C to A, chromosome 5 at 37,280,603 bp
  • T to C, chromosome 5 at 64,257,006 bp
  • C to A, chromosome 5 at 121,502,725 bp
  • A to G, chromosome 5 at 139,414,546 bp
  • G to A, chromosome 5 at 143,723,151 bp
  • A to C, chromosome 5 at 144,009,302 bp
  • G to T, chromosome 6 at 30,612,605 bp
  • T to C, chromosome 6 at 43,236,424 bp
  • G to T, chromosome 6 at 125,666,663 bp
  • A to G, chromosome 7 at 7,551,169 bp
  • A to T, chromosome 7 at 7,672,528 bp
  • T to A, chromosome 7 at 56,773,374 bp
  • T to C, chromosome 7 at 67,734,692 bp
  • A to G, chromosome 7 at 90,379,540 bp
  • T to C, chromosome 7 at 102,973,353 bp
  • T to C, chromosome 7 at 141,489,664 bp
  • T to A, chromosome 8 at 69,864,349 bp
  • A to T, chromosome 9 at 40,917,527 bp
  • A to T, chromosome 9 at 51,843,677 bp
  • T to C, chromosome 9 at 119,084,641 bp
  • A to T, chromosome 10 at 27,204,885 bp
  • A to G, chromosome 10 at 40,479,732 bp
  • A to T, chromosome 10 at 74,959,591 bp
  • C to G, chromosome 10 at 80,357,996 bp
  • A to G, chromosome 10 at 88,733,596 bp
  • A to T, chromosome 10 at 95,413,086 bp
  • A to G, chromosome 11 at 70,321,774 bp
  • T to C, chromosome 11 at 75,442,082 bp
  • A to T, chromosome 11 at 75,452,381 bp
  • C to A, chromosome 11 at 87,857,215 bp
  • C to A, chromosome 12 at 65,075,831 bp
  • T to C, chromosome 12 at 72,940,161 bp
  • T to G, chromosome 12 at 102,838,579 bp
  • C to T, chromosome 13 at 50,702,971 bp
  • G to A, chromosome 14 at 50,361,292 bp
  • G to A, chromosome 14 at 50,892,865 bp
  • A to G, chromosome 14 at 70,616,115 bp
  • A to G, chromosome 14 at 79,587,715 bp
  • T to C, chromosome 15 at 58,132,232 bp
  • A to G, chromosome 15 at 93,387,575 bp
  • A to G, chromosome 15 at 102,119,408 bp
  • A to G, chromosome 16 at 20,736,987 bp
  • T to C, chromosome 16 at 33,624,845 bp
  • T to C, chromosome 16 at 37,345,111 bp
  • T to A, chromosome 17 at 6,233,197 bp
  • A to G, chromosome 17 at 15,022,102 bp
  • T to C, chromosome 17 at 20,777,160 bp
  • C to A, chromosome 17 at 50,756,664 bp
  • A to G, chromosome 18 at 31,583,379 bp
  • T to C, chromosome 18 at 88,870,728 bp
  • C to A, chromosome 19 at 8,895,958 bp
  • T to G, chromosome 19 at 9,007,253 bp
  • A to T, chromosome 19 at 11,105,691 bp
  • G to A, chromosome X at 151,933,088 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9027 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068856-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.