Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9032Btlr/Mmmh
Stock Number:
068861-MU
Citation ID:
RRID:MMRRC_068861-MU
Other Names:
R9032 (G1)
Major Collection:

Strain Information

Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Nes
Name: nestin
Synonyms: Marc2, ESTM46, RC2, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Mrpl18
Name: mitochondrial ribosomal protein L18
Synonyms: HSPC071, MRP-L18, 1010001C05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67681
Homologene: 8566
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Dmtn
Name: dematin actin binding protein
Synonyms: dematin, Epb4.9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13829
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
Mtap
Name: methylthioadenosine phosphorylase
Synonyms: 1300019I21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66902
HGNC: HGNC:7413
Homologene: 1838
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68925
Homologene: 32269
Ankib1
Name: ankyrin repeat and IBR domain containing 1
Synonyms: 2310061P20Rik, 4631416I11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70797
Homologene: 19076
Slx4ip
Name: SLX4 interacting protein
Synonyms: 2410004I22Rik, 2210009G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74243
Homologene: 49913
Fer
Name: FER tyrosine kinase
Synonyms: Fert, C330004K01Rik, Fert2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14158
VEGA: 17
HGNC: HGNC:3655
Homologene: 74300
Fnbp1
Name: formin binding protein 1
Synonyms: FBP1, FBP17, 2210010H06Rik, 1110057E06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14269
Homologene: 100983
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Lmnb2
Name: lamin B2
Synonyms: lamin B3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16907
HGNC: HGNC:6638
Homologene: 7818
Slc6a11
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 11
Synonyms: GAT4, D930045G19Rik, E130202I16Rik, Gabt4, Gat3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243616
Homologene: 129935
Pfas
Name: phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms: 4432409B16Rik, Sofa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237823
HGNC: HGNC:8863
Homologene: 5970
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Il31ra
Name: interleukin 31 receptor A
Synonyms: GLM-R, GPL
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218624
VEGA: 13
Homologene: 51395
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Nxn
Name: nucleoredoxin
Synonyms: l11Jus13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18230
Homologene: 69028
Med19
Name: mediator complex subunit 19
Synonyms: LCMR1, 2410018M14Rik, 3110040A13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381379
Homologene: 14684
Emc1
Name: ER membrane protein complex subunit 1
Synonyms: C230096C10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230866
Homologene: 9002
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Tmtc1
Name: transmembrane and tetratricopeptide repeat containing 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387314
Homologene: 65299
Siglecg
Name: sialic acid binding Ig-like lectin G
Synonyms: mSiglec-G, A630096C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243958
Homologene: 13228
Fgf17
Name: fibroblast growth factor 17
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14171
VEGA: 14
HGNC: HGNC:3673
Homologene: 2872
Epb41l4b
Name: erythrocyte membrane protein band 4.1 like 4b
Synonyms: Ehm2, D4Ertd346e, 6430543G08Rik, Lulu2, Epb4.1l4b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54357
Homologene: 69270
Frmd4b
Name: FERM domain containing 4B
Synonyms: 6030440G05Rik, GRSP1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232288
Homologene: 14916
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Apoa4
Name: apolipoprotein A-IV
Synonyms: Apoa-4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11808
HGNC: HGNC:602
Homologene: 47927
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Hsh2d
Name: hematopoietic SH2 domain containing
Synonyms: ALX, Hsh2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209488
Homologene: 13142
Serpinb9h
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9h
Synonyms: Gm11397
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544923
HGNC: HGNC:8955
Homologene: 69093
Arhgap29
Name: Rho GTPase activating protein 29
Synonyms: 6720461J18Rik, Parg1, C76601, B130017I01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214137
Homologene: 3539
Abca8b
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, 4732458A06Rik, D130016K21Rik, 9430063L05Rik, Usmg4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Zbtb4
Name: zinc finger and BTB domain containing 4
Synonyms: 2310026P19Rik, 9230111I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75580
Homologene: 10846
Mroh5
Name: maestro heat-like repeat family member 5
Synonyms: LOC268816, Gm628
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268816
Psg23
Name: pregnancy-specific beta-1-glycoprotein 23
Synonyms: 1620401C02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56868
HGNC: HGNC:1819
Homologene: 110989
Mypn
Name: myopalladin
Synonyms: 1110056A04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68802
VEGA: 10
Homologene: 23778
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Wt1
Name: WT1 transcription factor
Synonyms: Wt-1, D630046I19Rik, Wilms tumor 1 homolog
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22431
Homologene: 11536
Acap1
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Synonyms: Centb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216859
Homologene: 22835
5031439G07Rik
Name: RIKEN cDNA 5031439G07 gene
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223739
HGNC: HGNC:1314
Homologene: 15140
Ctif
Name: CBP80/20-dependent translation initiation factor
Synonyms: LOC269037, Gm672
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269037
VEGA: 18
Homologene: 56682
Tlcd5
Name: TLC domain containing 5
Synonyms: LOC235300, Tmem136
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235300
VEGA: 9
Homologene: 72560
Qrfpr
Name: pyroglutamylated RFamide peptide receptor
Synonyms: AQ27, Gpr103
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229214
Homologene: 18865
Rsph6a
Name: radial spoke head 6 homolog A (Chlamydomonas)
Synonyms: RSP4, Rshl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83434
Homologene: 36476
Tas2r115
Name: taste receptor, type 2, member 115
Synonyms: Tas2r15, mGR15, mt2r49, T2R15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353325
Vav3
Name: vav 3 oncogene
Synonyms: A530094I06Rik, Idd18.1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Tmem132a
Name: transmembrane protein 132A
Synonyms: 6720481D13Rik, Hspa5bp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 98170
Homologene: 75076
Papss1
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Synonyms: SK1, Asapk
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23971
HGNC: HGNC:8603
Homologene: 81740
Afg1l
Name: AFG1 like ATPase
Synonyms: Lace1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215951
Homologene: 5782
Sesn1
Name: sestrin 1
Synonyms: 1110002G11Rik, SEST1, PA26
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140742
Homologene: 8697
Zfp51
Name: zinc finger protein 51
Synonyms: zfec12, Zfp-51
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22709
VEGA: 17
Homologene: 134003
Slc35d2
Name: solute carrier family 35, member D2
Synonyms: UGTrel8, SQV7L, hfrc, 5730408I21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70484
VEGA: 13
Homologene: 68119
Asb5
Name: ankyrin repeat and SOCs box-containing 5
Synonyms: 1110018D09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76294
Homologene: 12637
Pnma1
Name: paraneoplastic antigen MA1
Synonyms: 5730402C15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70481
HGNC: HGNC:9158
Homologene: 4399
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 2 at 31,083,005 bp
  • A to G, chromosome 2 at 84,685,316 bp
  • C to A, chromosome 2 at 105,126,815 bp
  • G to A, chromosome 2 at 119,778,295 bp
  • A to G, chromosome 2 at 137,068,320 bp
  • A to G, chromosome 2 at 157,193,153 bp
  • A to G, chromosome 3 at 36,221,950 bp
  • T to C, chromosome 3 at 86,126,685 bp
  • T to G, chromosome 3 at 87,979,762 bp
  • C to T, chromosome 3 at 88,981,987 bp
  • T to C, chromosome 3 at 88,984,222 bp
  • T to C, chromosome 3 at 97,694,069 bp
  • C to T, chromosome 3 at 109,506,406 bp
  • T to A, chromosome 3 at 122,014,600 bp
  • C to A, chromosome 3 at 131,619,056 bp
  • A to T, chromosome 4 at 57,041,064 bp
  • AC to A, chromosome 4 at 89,172,278 bp
  • T to C, chromosome 4 at 139,367,163 bp
  • T to C, chromosome 4 at 155,000,519 bp
  • T to C, chromosome 5 at 3,769,641 bp
  • A to C, chromosome 6 at 97,292,373 bp
  • A to T, chromosome 6 at 114,225,847 bp
  • G to T, chromosome 6 at 118,638,505 bp
  • A to T, chromosome 6 at 132,737,364 bp
  • A to T, chromosome 6 at 148,336,251 bp
  • T to G, chromosome 7 at 18,614,735 bp
  • A to T, chromosome 7 at 19,065,325 bp
  • T to C, chromosome 7 at 43,411,625 bp
  • T to A, chromosome 7 at 141,700,489 bp
  • A to T, chromosome 8 at 45,039,857 bp
  • A to T, chromosome 8 at 54,585,894 bp
  • T to C, chromosome 8 at 72,200,541 bp
  • T to C, chromosome 8 at 105,887,007 bp
  • C to T, chromosome 9 at 43,111,369 bp
  • T to A, chromosome 9 at 46,242,977 bp
  • C to T, chromosome 10 at 41,810,839 bp
  • G to A, chromosome 10 at 42,318,641 bp
  • T to G, chromosome 10 at 63,148,115 bp
  • T to C, chromosome 10 at 80,904,257 bp
  • C to T, chromosome 11 at 68,988,595 bp
  • T to A, chromosome 11 at 69,781,824 bp
  • T to C, chromosome 11 at 69,881,665 bp
  • A to G, chromosome 11 at 76,278,557 bp
  • C to T, chromosome 11 at 109,957,247 bp
  • T to C, chromosome 12 at 84,147,032 bp
  • T to C, chromosome 13 at 33,397,798 bp
  • C to T, chromosome 13 at 63,296,867 bp
  • A to G, chromosome 13 at 64,108,413 bp
  • T to A, chromosome 13 at 100,219,830 bp
  • T to C, chromosome 13 at 112,524,094 bp
  • A to G, chromosome 14 at 70,616,094 bp
  • A to G, chromosome 14 at 70,636,996 bp
  • G to A, chromosome 15 at 41,854,921 bp
  • T to C, chromosome 15 at 73,783,453 bp
  • C to T, chromosome 15 at 84,960,581 bp
  • A to C, chromosome 16 at 13,412,228 bp
  • A to T, chromosome 17 at 12,915,695 bp
  • T to A, chromosome 17 at 21,464,398 bp
  • C to T, chromosome 17 at 31,603,255 bp
  • T to A, chromosome 17 at 63,921,772 bp
  • CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC to CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC, chromosome 18 at 75,471,803 bp
  • G to T, chromosome 19 at 10,866,471 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9032 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068861-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.