Strain Name:
C57BL/6J-MtgxR9034Btlr/Mmmh
Stock Number:
068863-MU
Citation ID:
RRID:MMRRC_068863-MU
Other Names:
R9034 (G1)
Major Collection:

Strain Information

Trmt9b
Name: tRNA methyltransferase 9B
Synonyms: 6430573F11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319582
Homologene: 35306
Nes
Name: nestin
Synonyms: Ifaprc2, Marc2, ESTM46, RC2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Acvr2a
Name: activin receptor IIA
Synonyms: ActRIIa, tActRII, Acvr2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11480
HGNC: HGNC:173
Homologene: 20391
Vps54
Name: VPS54 GARP complex subunit
Synonyms: 5330404P15Rik, mSLP8, Vps54l, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Hmgcr
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms: 3-hydroxy-3-methylglutaryl-CoA reductase, HMG-CoAR, Red
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15357
HGNC: HGNC:5006
Homologene: 30994
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, nmf335, mnd-2, nmf58, ataxia 3, nmf2, motor end-plate disease, NaCh6, mnd2, C630029C19Rik, seal, NMF335, Nav1.6, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, C030005G16Rik, Walp3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Agfg1
Name: ArfGAP with FG repeats 1
Synonyms: Hrb, D730048C23Rik, C130049H11Rik, Rip
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15463
HGNC: HGNC:5175
Homologene: 37929
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: 9330189K18Rik, B230217J03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Krit1
Name: KRIT1, ankyrin repeat containing
Synonyms: 2010007K12Rik, Ccm1, Krit1, A630036P20Rik, Krit1B, Krit1A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 79264
HGNC: HGNC:1573
Homologene: 12746
Ehmt2
Name: euchromatic histone lysine N-methyltransferase 2
Synonyms: KMT1C, Bat8, D17Ertd710e, G9a, NG36
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110147
Homologene: 48460
Sphk1
Name: sphingosine kinase 1
Synonyms: 1110006G24Rik, SK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20698
Homologene: 39748
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NR2C, NMDAR2C, GluRepsilon3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Clint1
Name: clathrin interactor 1
Synonyms: Epn4, C530049I24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216705
Homologene: 133740
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: NCAM-140, NCAM-180, CD56, NCAM-1, E-NCAM, NCAM-120, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Nsd2
Name: nuclear receptor binding SET domain protein 2
Synonyms: 9430010A17Rik, 5830445G22Rik, D930023B08Rik, Whsc1l, C130020C13Rik, D030027O06Rik, Whsc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107823
Homologene: 26175
Mfsd14b
Name: major facilitator superfamily domain containing 14B
Synonyms: Hiatl1, 5730414C17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66631
Homologene: 64464
Akap11
Name: A kinase anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219181
HGNC: HGNC:369
Homologene: 8279
Plxna2
Name: plexin A2
Synonyms: Plxn2, 2810428A13Rik, OCT, PlexA2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Tnip2
Name: TNFAIP3 interacting protein 2
Synonyms: 1810020H16Rik, ABIN-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231130
Homologene: 11515
Myo7a
Name: myosin VIIA
Synonyms: Myo7, polka, USH1B, nmf371, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Trp73
Name: transformation related protein 73
Synonyms: deltaNp73, p73, TAp73
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22062
Homologene: 3960
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: A830009F23Rik, alphaMHC, Myhca, alpha myosin, Myhc-a, alpha-MHC, alpha cardiac MHC, cardiomyopathy, hypertrophic 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: D930026N18Rik, (alpha)1 subunit, L-type Cav1.2, Cchl1a1, Cav1.2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Impg1
Name: interphotoreceptor matrix proteoglycan 1
Synonyms: SPACR, A930015H12Rik, IMP150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 63859
HGNC: HGNC:6055
Homologene: 1201
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Abca9
Name: ATP-binding cassette, sub-family A member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Cmklr1
Name: chemerin chemokine-like receptor 1
Synonyms: ChemR23, Gpcr27
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14747
HGNC: HGNC:2121
Homologene: 129967
Fam227a
Name: family with sequence similarity 227, member A
Synonyms: 4933432B09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75729
Homologene: 123434
Cspg5
Name: chondroitin sulfate proteoglycan 5
Synonyms: NGC, CALEB, neuroglycan C
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 29873
HGNC: HGNC:2467
Homologene: 4795
F13b
Name: coagulation factor XIII, beta subunit
Synonyms: Cf-13b, Cf13b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14060
HGNC: HGNC:3534
Homologene: 1512
Nxt1
Name: NTF2-related export protein 1
Synonyms: 1110001N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56488
Homologene: 8301
Ercc6l2
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms: 0610007P08Rik, 1700019D06Rik, 9330134C04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76251
Homologene: 32564
H2-M2
Name: histocompatibility 2, M region locus 2
Synonyms: H-2M2, Thy19.4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14990
Homologene: 133732
F830016B08Rik
Name: RIKEN cDNA F830016B08 gene
Synonyms: Ifgga4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240328
VEGA: 18
Homologene: 129714
Pex5l
Name: peroxisomal biogenesis factor 5-like
Synonyms: TRIP8b, PXR2, 1700016J08Rik, Pex2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58869
Homologene: 9562
Tspan33
Name: tetraspanin 33
Synonyms: Penumbra, Pen, 1300010A20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232670
Homologene: 8213
Irag2
Name: inositol 1,4,5-triphosphate receptor associated 2
Synonyms: D6Int4, Lrmp, D6Int8, D6Int5, Jaw1, D6Int7, D6Int3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Or52n4
Name: olfactory receptor family 52 subfamily N member 4
Synonyms: Olfr658, MOR34-5, GA_x6K02T2PBJ9-7273558-7272587
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259051
Homologene: 105161
Cdkn2aip
Name: CDKN2A interacting protein
Synonyms: 4921511I16Rik, CARF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70925
Homologene: 9752
Or9g20
Name: olfactory receptor family 9 subfamily G member 20
Synonyms: Olfr1016, GA_x6K02T2Q125-47278889-47277960, MOR213-9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257915
Homologene: 83133
Or14c39
Name: olfactory receptor family 14 subfamily C member 39
Synonyms: GA_x6K02T2NHDJ-9425121-9424195, Olfr292, MOR220-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258613
Homologene: 115526
Or8b40
Name: olfactory receptor family 8 subfamily B member 40
Synonyms: MOR162-2, GA_x6K02T2PVTD-31795028-31795957, Olfr889
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258475
Homologene: 138311
Krtap26-1
Name: keratin associated protein 26-1
Synonyms: 2310002B14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69533
VEGA: 16
Homologene: 88911
Aldh3a1
Name: aldehyde dehydrogenase family 3, subfamily A1
Synonyms: Ahd4, Aldh3, Ahd-4, Aldh
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11670
HGNC: HGNC:405
Homologene: 20175
Or6f2
Name: olfactory receptor family 6 subfamily F member 2
Synonyms: Olfr523, GA_x6K02T2PBJ9-42327937-42328872, MOR104-4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258511
Homologene: 27191
Cant1
Name: calcium activated nucleotidase 1
Synonyms: 5830420C20Rik, SCAN-1, D11Bwg0554e, Shapy, Apy1h
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76025
Homologene: 69460
Serpina1e
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1E
Synonyms: PI5, Spi1-5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20704
HGNC: HGNC:8941
Homologene: 20103
Zscan4b
Name: zinc finger and SCAN domain containing 4B
Synonyms: EG665780
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665780
Homologene: 85986
Slc36a3
Name: solute carrier family 36 (proton/amino acid symporter), member 3
Synonyms: PAT3, tramdorin2, TRAMD2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215332
Homologene: 76175
Cenpn
Name: centromere protein N
Synonyms: 2610510J17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72155
Homologene: 12450
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
Sh3tc2
Name: SH3 domain and tetratricopeptide repeats 2
Synonyms: D430044G18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225608
VEGA: 18
Homologene: 11596
Rtkn2
Name: rhotekin 2
Synonyms: Mbf, RTKN2, Plekhk1, B130039D23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 170799
Homologene: 17065
Or8g50
Name: olfactory receptor family 8 subfamily G member 50
Synonyms: GA_x6K02T2PVTD-33434302-33435240, M93, MOR171-18, Olfr150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258602
VEGA: 9
Vmn2r31
Name: vomeronasal 2, receptor 31
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042591
Homologene: 113703
Tnfsf10
Name: tumor necrosis factor (ligand) superfamily, member 10
Synonyms: A330042I21Rik, APO-2L, Trail
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22035
Homologene: 2824
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Or5g24-ps1
Name: olfactory receptor family 5 subfamily G member 24, pseudogene 1
Synonyms: MOR175-6, Olfr1001-ps1, GA_x6K02T2Q125-47112820-47113764
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258078
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 82,876,192 bp
  • T to C, chromosome 1 at 133,914,591 bp
  • T to C, chromosome 1 at 139,508,223 bp
  • A to G, chromosome 1 at 194,793,889 bp
  • T to C, chromosome 2 at 48,873,369 bp
  • C to T, chromosome 2 at 76,712,527 bp
  • A to T, chromosome 2 at 85,633,800 bp
  • G to T, chromosome 2 at 85,799,958 bp
  • A to T, chromosome 2 at 148,675,411 bp
  • G to A, chromosome 3 at 27,335,230 bp
  • T to A, chromosome 3 at 32,952,534 bp
  • T to A, chromosome 3 at 87,978,428 bp
  • T to C, chromosome 4 at 154,067,631 bp
  • A to G, chromosome 5 at 3,812,996 bp
  • G to A, chromosome 5 at 33,880,134 bp
  • C to T, chromosome 5 at 34,513,833 bp
  • G to C, chromosome 5 at 113,613,982 bp
  • C to T, chromosome 6 at 29,717,612 bp
  • T to C, chromosome 6 at 118,751,398 bp
  • T to C, chromosome 6 at 145,137,547 bp
  • T to A, chromosome 7 at 7,394,681 bp
  • A to T, chromosome 7 at 10,900,913 bp
  • G to A, chromosome 7 at 86,694,761 bp
  • G to T, chromosome 7 at 98,079,258 bp
  • T to A, chromosome 7 at 104,644,628 bp
  • G to A, chromosome 7 at 140,176,971 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • C to T, chromosome 8 at 36,511,800 bp
  • C to A, chromosome 8 at 47,711,208 bp
  • T to A, chromosome 8 at 116,934,739 bp
  • G to A, chromosome 9 at 38,116,254 bp
  • G to A, chromosome 9 at 39,737,590 bp
  • A to T, chromosome 9 at 49,569,898 bp
  • T to A, chromosome 9 at 80,465,298 bp
  • T to C, chromosome 9 at 110,251,021 bp
  • A to G, chromosome 10 at 68,005,586 bp
  • G to A, chromosome 10 at 80,062,757 bp
  • A to G, chromosome 10 at 128,116,399 bp
  • T to C, chromosome 11 at 21,263,273 bp
  • C to A, chromosome 11 at 45,908,955 bp
  • T to A, chromosome 11 at 45,908,956 bp
  • A to T, chromosome 11 at 55,125,689 bp
  • A to G, chromosome 11 at 61,213,649 bp
  • T to C, chromosome 11 at 110,148,789 bp
  • C to T, chromosome 11 at 115,251,239 bp
  • T to C, chromosome 11 at 116,535,623 bp
  • T to A, chromosome 11 at 118,411,302 bp
  • T to A, chromosome 12 at 103,951,102 bp
  • T to C, chromosome 13 at 63,844,633 bp
  • G to T, chromosome 13 at 65,075,686 bp
  • A to G, chromosome 13 at 96,659,377 bp
  • A to T, chromosome 14 at 54,948,139 bp
  • C to A, chromosome 14 at 78,510,859 bp
  • A to G, chromosome 14 at 79,058,739 bp
  • T to C, chromosome 15 at 79,648,751 bp
  • T to A, chromosome 15 at 101,029,761 bp
  • CAC to CACTAC, chromosome 16 at 32,754,076 bp
  • A to T, chromosome 16 at 88,647,273 bp
  • T to A, chromosome 17 at 5,336,905 bp
  • C to A, chromosome 17 at 34,903,441 bp
  • A to T, chromosome 17 at 37,481,285 bp
  • A to G, chromosome 18 at 60,300,069 bp
  • A to G, chromosome 18 at 61,974,500 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9034 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068863-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.