Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9036Btlr/Mmmh
Stock Number:
068865-MU
Citation ID:
RRID:MMRRC_068865-MU
Other Names:
R9036 (G1)
Major Collection:

Strain Information

Cds2
Name: CDP-diacylglycerol synthase 2
Synonyms: 5730460C18Rik, D2Wsu127e, 5730450N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110911
HGNC: HGNC:1801
Homologene: 37854
Eno2
Name: enolase 2, gamma neuronal
Synonyms: Eno-2, D6Ertd375e, NSE
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13807
HGNC: HGNC:3353
Homologene: 74414
Ccn2
Name: cellular communication network factor 2
Synonyms: Hcs24, hypertrophic chondrocyte-specific gene product 24, Fisp12, Ccn2, Ctgf
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14219
HGNC: HGNC:2500
Homologene: 1431
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Zbtb8a
Name: zinc finger and BTB domain containing 8a
Synonyms: 2410081M15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73680
Homologene: 12506
Arl5b
Name: ADP-ribosylation factor-like 5B
Synonyms: 4930587A11Rik, Arl8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75869
Homologene: 101695
Fzd8
Name: frizzled class receptor 8
Synonyms: Fz8, mFZ8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14370
VEGA: 18
HGNC: HGNC:4046
Homologene: 40606
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 10,188,830 bp
  • A to T, chromosome 1 at 33,776,481 bp
  • A to G, chromosome 1 at 60,502,965 bp
  • A to G, chromosome 1 at 87,821,332 bp
  • A to G, chromosome 1 at 155,241,673 bp
  • A to G, chromosome 1 at 166,399,685 bp
  • A to T, chromosome 1 at 170,907,369 bp
  • T to C, chromosome 2 at 15,068,201 bp
  • T to A, chromosome 2 at 35,126,059 bp
  • A to G, chromosome 2 at 76,734,702 bp
  • T to C, chromosome 2 at 111,449,998 bp
  • T to A, chromosome 2 at 120,539,425 bp
  • T to C, chromosome 2 at 132,297,694 bp
  • T to A, chromosome 2 at 146,008,919 bp
  • G to A, chromosome 2 at 153,780,968 bp
  • C to A, chromosome 3 at 10,092,281 bp
  • T to C, chromosome 3 at 58,416,076 bp
  • T to C, chromosome 3 at 87,931,995 bp
  • T to A, chromosome 3 at 94,767,241 bp
  • T to C, chromosome 3 at 103,043,660 bp
  • A to G, chromosome 3 at 154,763,249 bp
  • A to G, chromosome 4 at 21,832,201 bp
  • C to A, chromosome 4 at 82,913,548 bp
  • T to C, chromosome 4 at 94,947,057 bp
  • A to T, chromosome 4 at 126,240,118 bp
  • T to C, chromosome 4 at 129,354,266 bp
  • C to A, chromosome 4 at 140,795,693 bp
  • A to G, chromosome 4 at 141,249,238 bp
  • T to A, chromosome 4 at 149,469,025 bp
  • A to G, chromosome 5 at 5,740,708 bp
  • A to T, chromosome 5 at 34,635,407 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • G to A, chromosome 5 at 122,109,283 bp
  • A to G, chromosome 5 at 122,819,653 bp
  • A to G, chromosome 5 at 137,465,944 bp
  • T to C, chromosome 6 at 12,418,250 bp
  • CCTAAATTTCCTATCCCGATCAGCAAGGGTGGCCCTCGAGTGCCCCAGCCCCATGCTAAATTTCC to CCTAAATTTCC, chromosome 6 at 48,988,140 bp
  • A to T, chromosome 6 at 92,069,466 bp
  • G to A, chromosome 6 at 113,399,696 bp
  • A to T, chromosome 6 at 124,763,128 bp
  • A to T, chromosome 7 at 88,036,189 bp
  • C to T, chromosome 7 at 118,725,457 bp
  • T to A, chromosome 8 at 13,595,851 bp
  • T to A, chromosome 8 at 31,155,786 bp
  • A to G, chromosome 8 at 70,720,420 bp
  • A to G, chromosome 8 at 110,887,432 bp
  • G to A, chromosome 8 at 122,488,351 bp
  • A to T, chromosome 9 at 7,051,495 bp
  • A to C, chromosome 9 at 7,387,909 bp
  • A to T, chromosome 9 at 18,644,679 bp
  • G to A, chromosome 9 at 18,816,273 bp
  • A to G, chromosome 9 at 54,338,463 bp
  • A to T, chromosome 9 at 59,780,301 bp
  • A to T, chromosome 9 at 60,587,867 bp
  • T to A, chromosome 9 at 107,783,712 bp
  • A to T, chromosome 10 at 24,596,749 bp
  • A to G, chromosome 10 at 28,585,932 bp
  • G to A, chromosome 10 at 30,198,527 bp
  • A to G, chromosome 10 at 34,056,790 bp
  • T to C, chromosome 10 at 58,270,589 bp
  • A to G, chromosome 10 at 121,611,675 bp
  • A to G, chromosome 10 at 127,183,220 bp
  • A to T, chromosome 11 at 40,752,251 bp
  • G to T, chromosome 11 at 54,337,014 bp
  • A to T, chromosome 11 at 102,352,453 bp
  • A to G, chromosome 11 at 105,036,775 bp
  • T to C, chromosome 12 at 58,212,783 bp
  • A to G, chromosome 12 at 109,593,257 bp
  • A to G, chromosome 12 at 110,639,752 bp
  • A to T, chromosome 12 at 113,062,484 bp
  • A to G, chromosome 12 at 113,144,410 bp
  • T to C, chromosome 13 at 26,769,445 bp
  • A to T, chromosome 13 at 34,911,024 bp
  • T to A, chromosome 13 at 91,040,952 bp
  • G to A, chromosome 13 at 96,946,534 bp
  • A to T, chromosome 14 at 44,656,420 bp
  • G to A, chromosome 14 at 65,762,748 bp
  • A to T, chromosome 14 at 120,325,300 bp
  • T to G, chromosome 14 at 121,912,255 bp
  • C to T, chromosome 15 at 8,223,138 bp
  • C to T, chromosome 15 at 71,890,582 bp
  • A to G, chromosome 15 at 82,616,322 bp
  • C to T, chromosome 15 at 95,296,236 bp
  • A to G, chromosome 15 at 97,867,208 bp
  • A to T, chromosome 16 at 19,624,545 bp
  • T to A, chromosome 16 at 33,706,969 bp
  • T to C, chromosome 17 at 6,649,308 bp
  • C to A, chromosome 17 at 7,351,655 bp
  • T to C, chromosome 17 at 9,669,352 bp
  • C to T, chromosome 17 at 23,668,184 bp
  • T to A, chromosome 17 at 24,208,517 bp
  • T to G, chromosome 17 at 37,924,277 bp
  • A to G, chromosome 18 at 9,214,661 bp
  • T to A, chromosome 18 at 78,349,931 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9036 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068865-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.