Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9040Btlr/Mmmh
Stock Number:
068867-MU
Citation ID:
RRID:MMRRC_068867-MU
Other Names:
R9040 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Tfap2b
Name: transcription factor AP-2 beta
Synonyms: AP-2(beta), E130018K07Rik, Tcfap2b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21419
Homologene: 20688
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Agap1
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 347722
Homologene: 56689
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 19,234,090 bp
  • T to C, chromosome 1 at 89,743,744 bp
  • T to A, chromosome 1 at 91,501,370 bp
  • T to G, chromosome 1 at 131,840,885 bp
  • T to A, chromosome 1 at 163,062,500 bp
  • A to G, chromosome 1 at 181,817,345 bp
  • C to A, chromosome 2 at 32,707,987 bp
  • G to T, chromosome 2 at 39,075,152 bp
  • A to G, chromosome 2 at 66,317,901 bp
  • A to G, chromosome 2 at 112,954,386 bp
  • T to C, chromosome 2 at 142,849,878 bp
  • A to G, chromosome 3 at 36,575,838 bp
  • A to T, chromosome 3 at 95,580,159 bp
  • A to T, chromosome 4 at 99,001,127 bp
  • C to A, chromosome 4 at 148,463,748 bp
  • C to G, chromosome 4 at 154,980,102 bp
  • A to T, chromosome 5 at 5,682,722 bp
  • T to A, chromosome 5 at 35,515,491 bp
  • T to C, chromosome 5 at 105,480,295 bp
  • T to C, chromosome 5 at 108,681,063 bp
  • A to T, chromosome 5 at 137,574,705 bp
  • T to C, chromosome 5 at 145,456,112 bp
  • A to T, chromosome 6 at 78,426,285 bp
  • A to G, chromosome 6 at 85,347,933 bp
  • T to C, chromosome 6 at 121,787,479 bp
  • A to T, chromosome 7 at 11,612,711 bp
  • C to T, chromosome 7 at 64,743,324 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to C, chromosome 8 at 43,650,326 bp
  • A to T, chromosome 8 at 109,602,149 bp
  • G to A, chromosome 9 at 18,644,786 bp
  • G to T, chromosome 9 at 21,794,819 bp
  • A to T, chromosome 9 at 75,174,059 bp
  • G to A, chromosome 9 at 119,121,917 bp
  • A to T, chromosome 10 at 18,201,350 bp
  • T to C, chromosome 10 at 30,654,393 bp
  • A to G, chromosome 10 at 58,223,786 bp
  • T to A, chromosome 10 at 80,154,084 bp
  • G to T, chromosome 10 at 94,943,517 bp
  • A to G, chromosome 10 at 130,418,442 bp
  • T to C, chromosome 11 at 32,213,063 bp
  • A to G, chromosome 11 at 35,703,309 bp
  • T to C, chromosome 11 at 77,973,936 bp
  • G to A, chromosome 11 at 94,491,923 bp
  • T to C, chromosome 11 at 99,316,553 bp
  • C to T, chromosome 11 at 99,331,267 bp
  • G to A, chromosome 11 at 100,267,033 bp
  • A to G, chromosome 11 at 108,014,360 bp
  • C to T, chromosome 12 at 98,434,839 bp
  • T to C, chromosome 13 at 11,594,786 bp
  • T to C, chromosome 13 at 21,484,059 bp
  • T to A, chromosome 14 at 45,343,654 bp
  • G to T, chromosome 14 at 50,485,538 bp
  • C to A, chromosome 16 at 45,444,146 bp
  • T to A, chromosome 17 at 25,163,819 bp
  • A to G, chromosome 17 at 31,238,986 bp
  • A to T, chromosome 18 at 36,675,737 bp
  • T to C, chromosome 18 at 59,409,688 bp
  • T to C, chromosome 18 at 61,001,288 bp
  • T to A, chromosome 18 at 62,937,343 bp
  • T to C, chromosome 18 at 65,209,663 bp
  • T to C, chromosome 19 at 17,120,627 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9040 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068867-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.