Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9040Btlr/Mmmh
Stock Number:
068867-MU
Citation ID:
RRID:MMRRC_068867-MU
Other Names:
R9040 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Tfap2b
Name: transcription factor AP-2 beta
Synonyms: AP-2(beta), E130018K07Rik, Tcfap2b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21419
Homologene: 20688
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Agap1
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 347722
Homologene: 56689
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Tfr2
Name: transferrin receptor 2
Synonyms: Tfr2, Trfr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50765
Homologene: 2428
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Traf3ip1
Name: TRAF3 interacting protein 1
Synonyms: 3930402D05Rik, MIP-T3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74019
Homologene: 22913
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: 1300012C07Rik, Nedd4-2, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Kank2
Name: KN motif and ankyrin repeat domains 2
Synonyms: Ankrd25
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235041
VEGA: 9
Homologene: 9163
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Krt25
Name: keratin 25
Synonyms: 4631426H08Rik, mIRSa1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70810
Homologene: 77127
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Steap2
Name: six transmembrane epithelial antigen of prostate 2
Synonyms: 4921538B17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74051
Homologene: 17682
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Midn
Name: midnolin
Synonyms: 3000003C15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59090
Homologene: 32510
Psmc6
Name: proteasome (prosome, macropain) 26S subunit, ATPase, 6
Synonyms: 2300001E01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67089
VEGA: 14
HGNC: HGNC:9553
Homologene: 100630
Lbr
Name: lamin B receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Dhodh
Name: dihydroorotate dehydrogenase
Synonyms: 2810417D19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56749
HGNC: HGNC:2867
Homologene: 1043
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Hormad1
Name: HORMA domain containing 1
Synonyms: 4921522K05Rik, Nohma
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67981
Homologene: 69415
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Bbs7
Name: Bardet-Biedl syndrome 7
Synonyms: 8430406N16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71492
Homologene: 12395
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Mug5
Name: murinoglobulin 5
Synonyms: Gm7298
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 640530
HGNC: HGNC:9750
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Adam34
Name: a disintegrin and metallopeptidase domain 34
Synonyms: testase 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 252866
Homologene: 78104
Vmn2r85
Name: vomeronasal 2, receptor 85
Synonyms: EG623734
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 623734
Homologene: 129606
Rhbdf1
Name: rhomboid 5 homolog 1
Synonyms: Dist1, Egfr-rs, Dist
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13650
Homologene: 32085
Or11g25
Name: olfactory receptor family 11 subfamily G member 25
Synonyms: GA_x6K02T2PMLR-6197851-6198786, MOR106-10, MOR106-15, Olfr741
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258233
Slc6a7
Name: solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
Synonyms: Prot
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240332
VEGA: 18
Homologene: 8592
Zkscan4
Name: zinc finger with KRAB and SCAN domains 4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544922
Homologene: 128718
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Krt26
Name: keratin 26
Synonyms: 4732407F15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320864
Homologene: 37118
Krt42
Name: keratin 42
Synonyms: Ka22, K17n, ecat6, 2410039E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68239
Homologene: 107091
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: EIG180, Drapc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Plxnc1
Name: plexin C1
Synonyms: vespr, CD232, 2510048K12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Scai
Name: suppressor of cancer cell invasion
Synonyms: A930041I02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320271
Homologene: 15523
Slc41a1
Name: solute carrier family 41, member 1
Synonyms: B230315F01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98396
Homologene: 14871
Ccdc154
Name: coiled-coil domain containing 154
Synonyms: LOC207209, ntl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207209
Homologene: 19361
Cdk9
Name: cyclin dependent kinase 9
Synonyms: PITALRE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107951
HGNC: HGNC:1780
Homologene: 55566
Cpz
Name: carboxypeptidase Z
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242939
HGNC: HGNC:2333
Homologene: 2709
Cyp3a16
Name: cytochrome P450, family 3, subfamily a, polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13114
HGNC: HGNC:2638
Homologene: 133568
Apba2
Name: amyloid beta precursor protein binding family A member 2
Synonyms: X11-like, X11L, Mint 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11784
HGNC: HGNC:579
Homologene: 4021
Kcnk10
Name: potassium channel, subfamily K, member 10
Synonyms: 3010005K24Rik, 1700024D23Rik, Trek2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72258
VEGA: 12
HGNC: HGNC:6273
Homologene: 11321
Cd200l1
Name: CD200 molecule like 1
Synonyms: LOC208166, LOC385647, Gm609, iSEC1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208166
Homologene: 86707
Duxf1
Name: double homeobox family member 1
Synonyms: AW822073
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100504180
Homologene: 134545
Rab11fip5
Name: RAB11 family interacting protein 5 (class I)
Synonyms: 9130206P09Rik, RIP11, GAF1, D6Ertd32e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52055
Homologene: 9158
Lrrc8b
Name: leucine rich repeat containing 8 family, member B
Synonyms: R75581, 2210408K08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433926
Homologene: 9103
Reg1
Name: regenerating islet-derived 1
Synonyms: pancreatic stone protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19692
Homologene: 68282
Sra1
Name: steroid receptor RNA activator 1
Synonyms: Srap
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 24068
Homologene: 11906
Ubash3a
Name: ubiquitin associated and SH3 domain containing, A
Synonyms: 5830413C03Rik, Sts-2, TULA
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328795
Homologene: 56833
Epn3
Name: epsin 3
Synonyms: 2310022G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71889
Homologene: 56791
Mroh9
Name: maestro heat-like repeat family member 9
Synonyms: Armc11, 4921528O07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78258
Homologene: 123521
Zscan4-ps3
Name: zinc finger and SCAN domain containing 4, pseudogene 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043042
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 19,234,090 bp
  • T to C, chromosome 1 at 89,743,744 bp
  • T to A, chromosome 1 at 91,501,370 bp
  • T to G, chromosome 1 at 131,840,885 bp
  • T to A, chromosome 1 at 163,062,500 bp
  • A to G, chromosome 1 at 181,817,345 bp
  • C to A, chromosome 2 at 32,707,987 bp
  • G to T, chromosome 2 at 39,075,152 bp
  • A to G, chromosome 2 at 66,317,901 bp
  • A to G, chromosome 2 at 112,954,386 bp
  • T to C, chromosome 2 at 142,849,878 bp
  • A to G, chromosome 3 at 36,575,838 bp
  • A to T, chromosome 3 at 95,580,159 bp
  • A to T, chromosome 4 at 99,001,127 bp
  • C to A, chromosome 4 at 148,463,748 bp
  • C to G, chromosome 4 at 154,980,102 bp
  • A to T, chromosome 5 at 5,682,722 bp
  • T to A, chromosome 5 at 35,515,491 bp
  • T to C, chromosome 5 at 105,480,295 bp
  • T to C, chromosome 5 at 108,681,063 bp
  • A to T, chromosome 5 at 137,574,705 bp
  • T to C, chromosome 5 at 145,456,112 bp
  • A to T, chromosome 6 at 78,426,285 bp
  • A to G, chromosome 6 at 85,347,933 bp
  • T to C, chromosome 6 at 121,787,479 bp
  • A to T, chromosome 7 at 11,612,711 bp
  • C to T, chromosome 7 at 64,743,324 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to C, chromosome 8 at 43,650,326 bp
  • A to T, chromosome 8 at 109,602,149 bp
  • G to A, chromosome 9 at 18,644,786 bp
  • G to T, chromosome 9 at 21,794,819 bp
  • A to T, chromosome 9 at 75,174,059 bp
  • G to A, chromosome 9 at 119,121,917 bp
  • A to T, chromosome 10 at 18,201,350 bp
  • T to C, chromosome 10 at 30,654,393 bp
  • A to G, chromosome 10 at 58,223,786 bp
  • T to A, chromosome 10 at 80,154,084 bp
  • G to T, chromosome 10 at 94,943,517 bp
  • A to G, chromosome 10 at 130,418,442 bp
  • T to C, chromosome 11 at 32,213,063 bp
  • A to G, chromosome 11 at 35,703,309 bp
  • T to C, chromosome 11 at 77,973,936 bp
  • G to A, chromosome 11 at 94,491,923 bp
  • T to C, chromosome 11 at 99,316,553 bp
  • C to T, chromosome 11 at 99,331,267 bp
  • G to A, chromosome 11 at 100,267,033 bp
  • A to G, chromosome 11 at 108,014,360 bp
  • C to T, chromosome 12 at 98,434,839 bp
  • T to C, chromosome 13 at 11,594,786 bp
  • T to C, chromosome 13 at 21,484,059 bp
  • T to A, chromosome 14 at 45,343,654 bp
  • G to T, chromosome 14 at 50,485,538 bp
  • C to A, chromosome 16 at 45,444,146 bp
  • T to A, chromosome 17 at 25,163,819 bp
  • A to G, chromosome 17 at 31,238,986 bp
  • A to T, chromosome 18 at 36,675,737 bp
  • T to C, chromosome 18 at 59,409,688 bp
  • T to C, chromosome 18 at 61,001,288 bp
  • T to A, chromosome 18 at 62,937,343 bp
  • T to C, chromosome 18 at 65,209,663 bp
  • T to C, chromosome 19 at 17,120,627 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9040 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068867-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.