Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9051Btlr/Mmmh
Stock Number:
068877-MU
Citation ID:
RRID:MMRRC_068877-MU
Other Names:
R9051 (G1)
Major Collection:

Strain Information

Traf4
Name: TNF receptor associated factor 4
Synonyms: CART1, A530032M13Rik, msp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22032
Homologene: 3173
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
HGNC: HGNC:6697
Homologene: 1746
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 36,701,453 bp
  • A to G, chromosome 1 at 44,087,976 bp
  • G to A, chromosome 1 at 75,315,685 bp
  • A to T, chromosome 1 at 87,597,243 bp
  • T to C, chromosome 1 at 92,597,256 bp
  • G to T, chromosome 1 at 134,184,181 bp
  • A to T, chromosome 1 at 136,260,288 bp
  • A to C, chromosome 2 at 76,719,108 bp
  • G to T, chromosome 2 at 76,787,251 bp
  • A to T, chromosome 2 at 104,762,947 bp
  • T to C, chromosome 2 at 112,111,096 bp
  • G to T, chromosome 2 at 120,745,430 bp
  • T to A, chromosome 2 at 128,158,301 bp
  • G to T, chromosome 2 at 136,069,134 bp
  • C to T, chromosome 2 at 152,143,770 bp
  • A to G, chromosome 3 at 59,329,247 bp
  • A to T, chromosome 3 at 83,354,186 bp
  • T to C, chromosome 3 at 102,946,111 bp
  • T to C, chromosome 3 at 123,671,900 bp
  • C to A, chromosome 4 at 34,551,148 bp
  • T to G, chromosome 4 at 46,468,592 bp
  • A to G, chromosome 4 at 73,638,948 bp
  • A to C, chromosome 4 at 84,291,901 bp
  • A to G, chromosome 4 at 91,311,610 bp
  • G to T, chromosome 4 at 105,049,403 bp
  • T to C, chromosome 4 at 141,632,421 bp
  • C to T, chromosome 4 at 152,038,376 bp
  • T to A, chromosome 5 at 45,695,798 bp
  • G to T, chromosome 5 at 73,607,924 bp
  • C to T, chromosome 5 at 73,607,925 bp
  • A to C, chromosome 5 at 90,263,275 bp
  • A to G, chromosome 5 at 103,867,843 bp
  • C to A, chromosome 5 at 104,518,952 bp
  • C to A, chromosome 5 at 146,845,297 bp
  • T to A, chromosome 6 at 3,373,493 bp
  • T to C, chromosome 6 at 48,765,325 bp
  • A to G, chromosome 6 at 113,763,605 bp
  • G to A, chromosome 6 at 115,585,364 bp
  • A to T, chromosome 6 at 118,165,927 bp
  • C to T, chromosome 7 at 25,686,037 bp
  • A to G, chromosome 7 at 30,876,024 bp
  • C to A, chromosome 7 at 45,237,198 bp
  • A to T, chromosome 7 at 105,692,726 bp
  • A to G, chromosome 7 at 121,742,343 bp
  • G to A, chromosome 7 at 123,983,457 bp
  • A to C, chromosome 7 at 133,671,478 bp
  • A to G, chromosome 7 at 143,460,227 bp
  • T to C, chromosome 8 at 11,448,198 bp
  • T to A, chromosome 8 at 34,817,191 bp
  • T to A, chromosome 8 at 105,887,201 bp
  • A to G, chromosome 8 at 110,653,237 bp
  • A to T, chromosome 8 at 110,983,596 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • TTATA to TTATATATA, chromosome 9 at 78,712,531 bp
  • G to A, chromosome 10 at 58,235,889 bp
  • G to A, chromosome 10 at 79,548,440 bp
  • A to T, chromosome 11 at 9,335,232 bp
  • T to G, chromosome 11 at 48,987,089 bp
  • C to A, chromosome 11 at 49,636,771 bp
  • G to A, chromosome 11 at 51,048,111 bp
  • T to C, chromosome 11 at 65,186,969 bp
  • C to T, chromosome 11 at 70,247,327 bp
  • A to T, chromosome 11 at 78,161,179 bp
  • G to T, chromosome 11 at 79,473,342 bp
  • T to A, chromosome 11 at 116,854,039 bp
  • T to C, chromosome 12 at 33,367,421 bp
  • T to C, chromosome 12 at 57,737,163 bp
  • T to A, chromosome 13 at 68,584,952 bp
  • C to T, chromosome 13 at 73,569,912 bp
  • T to A, chromosome 13 at 100,741,207 bp
  • T to A, chromosome 14 at 34,147,126 bp
  • A to G, chromosome 14 at 79,086,710 bp
  • A to C, chromosome 15 at 6,852,546 bp
  • T to C, chromosome 15 at 27,732,684 bp
  • A to G, chromosome 15 at 38,002,259 bp
  • T to A, chromosome 15 at 101,817,882 bp
  • C to T, chromosome 15 at 102,217,924 bp
  • G to T, chromosome 16 at 20,609,015 bp
  • A to T, chromosome 16 at 25,412,912 bp
  • C to A, chromosome 16 at 30,309,158 bp
  • T to G, chromosome 16 at 36,510,052 bp
  • T to A, chromosome 17 at 22,006,584 bp
  • G to A, chromosome 17 at 52,834,614 bp
  • T to A, chromosome 17 at 66,555,869 bp
  • T to C, chromosome 17 at 70,844,887 bp
  • G to T, chromosome 17 at 80,408,294 bp
  • C to A, chromosome 17 at 86,120,687 bp
  • T to C, chromosome 18 at 43,329,749 bp
  • T to C, chromosome 18 at 54,899,194 bp
  • T to C, chromosome 18 at 58,900,976 bp
  • G to T, chromosome 19 at 3,630,156 bp
  • T to C, chromosome 19 at 4,923,144 bp
  • C to T, chromosome 19 at 48,206,370 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9051 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068877-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.