Strain Name:
C57BL/6J-MtgxR9051Btlr/Mmmh
Stock Number:
068877-MU
Citation ID:
RRID:MMRRC_068877-MU
Other Names:
R9051 (G1)
Major Collection:

Strain Information

Traf4
Name: TNF receptor associated factor 4
Synonyms: CART1, A530032M13Rik, msp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22032
Homologene: 3173
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LR3, LRP7
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
Homologene: 1746
Elavl2
Name: ELAV like RNA binding protein 1
Synonyms: mel-N1, Hub
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15569
HGNC: HGNC:3313
Homologene: 20930
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Anp32b
Name: acidic nuclear phosphoprotein 32 family member B
Synonyms: PHAPI2a, PAL31, 2410015B15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67628
Homologene: 137872
Dpp3
Name: dipeptidylpeptidase 3
Synonyms: 4930533O14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 75221
VEGA: 19
HGNC: HGNC:3008
Homologene: 40210
Ddx19a
Name: DEAD box helicase 19a
Synonyms: Eif4a-rs1, DBP5, Ddx19, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13680
Homologene: 5240
Srbd1
Name: S1 RNA binding domain 1
Synonyms: D530025C17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78586
VEGA: 17
Homologene: 9994
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70427
Homologene: 18941
Gp5
Name: glycoprotein 5 platelet
Synonyms: GPV, GP V
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14729
VEGA: 16
HGNC: HGNC:4443
Homologene: 74523
Sos1
Name: SOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms: 4430401P03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20662
VEGA: 17
Homologene: 4117
Tgif1
Name: TGFB-induced factor homeobox 1
Synonyms: Tgif
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21815
Homologene: 7574
Casr
Name: calcium-sensing receptor
Synonyms: CaR, Gprc2a, cation sensing receptor
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12374
HGNC: HGNC:1514
Homologene: 332
Lamp5
Name: lysosomal-associated membrane protein family, member 5
Synonyms: 3110035N03Rik, BAD-LAMP, 6330527O06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76161
Homologene: 8173
Slc6a3
Name: solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
Synonyms: DAT, Dat1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13162
VEGA: 13
Homologene: 55547
Bcl2l11
Name: BCL2 like 11
Synonyms: Bod, Bim, 1500006F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12125
HGNC: HGNC:994
Homologene: 7643
Dnpep
Name: aspartyl aminopeptidase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13437
HGNC: HGNC:2981
Homologene: 6110
Akirin2
Name: akirin 2
Synonyms: 2700059D21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433693
Homologene: 9988
Mrps36
Name: mitochondrial ribosomal protein S36
Synonyms: 1110018B13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66128
Homologene: 11924
Plekhm2
Name: pleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms: 2310034J19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69582
Homologene: 19575
Edrf1
Name: erythroid differentiation regulatory factor 1
Synonyms: 2700050L05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214764
Homologene: 27985
Mettl23
Name: methyltransferase like 23
Synonyms: 4933424L15Rik, 1500035B17Rik, 1110005A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74319
Homologene: 12552
Tex30
Name: testis expressed 30
Synonyms: 3110030D08Rik, 1700029F09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75623
Homologene: 16344
Ncapg
Name: non-SMC condensin I complex, subunit G
Synonyms: MFT.M05.13, Hcapg, 5730507H05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54392
Homologene: 44071
Qser1
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99003
Homologene: 11710
Vac14
Name: Vac14 homolog (S. cerevisiae)
Synonyms: Trx, Tax1bp2, D8Wsu151e, ingls
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234729
Homologene: 6528
Dusp4
Name: dual specificity phosphatase 4
Synonyms: E130306H24Rik, 2700078F24Rik, MKP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319520
HGNC: HGNC:3070
Homologene: 1065
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, D6Abb2e, wms, jog, Tmy, Gena300
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Cd22
Name: CD22 antigen
Synonyms: Lyb-8, Lyb8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12483
HGNC: HGNC:1643
Homologene: 31052
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Klhl8
Name: kelch-like 8
Synonyms: 2310001P09Rik, D5Ertd431e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246293
Homologene: 10819
Ret
Name: ret proto-oncogene
Synonyms: RET51, RET9, c-Ret
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19713
HGNC: HGNC:9967
Homologene: 7517
Scnn1g
Name: sodium channel, nonvoltage-gated 1 gamma
Synonyms: ENaC gamma
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20278
Homologene: 20280
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Prkaa2
Name: protein kinase, AMP-activated, alpha 2 catalytic subunit
Synonyms: 2310008I11Rik, AMPKalpha2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108079
HGNC: HGNC:9377
Homologene: 4551
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dpysl3
Name: dihydropyrimidinase-like 3
Synonyms: Ulip1, Ulip, CRMP-4, TUC4, 9430041P20Rik, CRMP4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22240
HGNC: HGNC:3015
Homologene: 20361
Zfp608
Name: zinc finger protein 608
Synonyms: 4932417D18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269023
VEGA: 18
Homologene: 18485
Npy4r
Name: neuropeptide Y receptor Y4
Synonyms: NYYR-D, Y4, Ppyr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19065
VEGA: 14
Homologene: 38119
Duxf4
Name: double homeobox family member 4
Synonyms: Duxf4, Gm4981
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 245263
Homologene: 134545
Nr1h5
Name: nuclear receptor subfamily 1, group H, member 5
Synonyms: FXRB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381463
Homologene: 131277
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Chi3l1
Name: chitinase 3 like 1
Synonyms: Brp39, Gp39, Chil1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12654
HGNC: HGNC:1932
Homologene: 55569
Myocd
Name: myocardin
Synonyms: Srfcp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 214384
Homologene: 17043
Adamts19
Name: ADAM metallopeptidase with thrombospondin type 1 motif 19
Synonyms: D230034E10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240322
VEGA: 18
Homologene: 15860
Neu2
Name: neuraminidase 2
Synonyms: brain sialidase, cystolic sialidase, MSS, MBS, MTS
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23956
HGNC: HGNC:7759
Homologene: 3927
Itgb7
Name: integrin beta 7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16421
HGNC: HGNC:6162
Homologene: 20247
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231296
Homologene: 51944
Tgtp1
Name: T cell specific GTPase 1
Synonyms: Mg21, Gtp2, Tgtp, Irgb6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21822
Homologene: 129991
Hs3st4
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 4
Synonyms: Gm6915
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628779
HGNC: HGNC:5200
Homologene: 82444
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
Krt2
Name: keratin 2
Synonyms: Krt2-2, Krt2e, Krt2-17
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16681
HGNC: HGNC:6439
Alox12
Name: arachidonate 12-lipoxygenase
Synonyms: P-12LO, Alox12p, 9930022G08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11684
HGNC: HGNC:429
Homologene: 560
Or1x6
Name: olfactory receptor family 1 subfamily X member 6
Synonyms: GA_x6K02T2QP88-4389999-4389056, MOR126-2, Olfr1375-ps1, Olfr1375
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258509
Atxn7l1
Name: ataxin 7-like 1
Synonyms: 2810423G08Rik, Atxn7l4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380753
Homologene: 53366
Ttbk2
Name: tau tubulin kinase 2
Synonyms: TTK, B930008N24Rik, 2610507N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Thoc2l
Name: THO complex subunit 2-like
Synonyms: Gm3179, BC005561
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100042165
Gimap3
Name: GTPase, IMAP family member 3
Synonyms: 2010110D23Rik, Ian4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 83408
Homologene: 41257
Themis3
Name: thymocyte selection associated family member 3
Synonyms: 9130404H23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74556
Homologene: 137389
Flt4
Name: FMS-like tyrosine kinase 4
Synonyms: VEGFR3, VEGFR-3, Flt-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14257
HGNC: HGNC:3767
Homologene: 7321
Sorcs3
Name: sortilin-related VPS10 domain containing receptor 3
Synonyms: 6330404A12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66673
VEGA: 19
Homologene: 8986
Tprg1
Name: transformation related protein 63 regulated 1
Synonyms: 5430420C16Rik, Tprg
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71338
Homologene: 18415
Mkrn2os
Name: makorin, ring finger protein 2, opposite strand
Synonyms: 2510049J12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70291
Homologene: 66298
Gm9772
Name: predicted gene 9772
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100416807
VEGA: 17
Fastkd3
Name: FAST kinase domains 3
Synonyms: 2310010B21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69577
VEGA: 13
Homologene: 11457
B9d2
Name: B9 protein domain 2
Synonyms: stumpy
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232987
Homologene: 12733
Actr1b
Name: ARP1 actin-related protein 1B, centractin beta
Synonyms: Arp1b, 2310066K23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226977
HGNC: HGNC:168
Homologene: 101541
Tas1r1
Name: taste receptor, type 1, member 1
Synonyms: TR1, T1r1, Gpr70, T1R1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110326
Homologene: 12888
Alg3
Name: ALG3 alpha-1,3- mannosyltransferase
Synonyms: D16Ertd36e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208624
Homologene: 4228
Rasl11a
Name: RAS-like, family 11, member A
Synonyms: 1110065D03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68895
Homologene: 45783
Gpr25
Name: G protein-coupled receptor 25
Synonyms: LOC383563
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383563
HGNC: HGNC:4480
Homologene: 3872
Cdkn1c
Name: cyclin dependent kinase inhibitor 1C
Synonyms: Kip2, p57Kip2, CDKI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12577
HGNC: HGNC:1786
Homologene: 134519
Or9s15
Name: olfactory receptor family 9 subfamily S member 15
Synonyms: GA_x6K02T2R7CC-81157497-81156526, MOR208-3, Olfr1411
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258483
Homologene: 115530
Tcf15
Name: transcription factor 15
Synonyms: bHLH-EC2, paraxis, Meso1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21407
Homologene: 37943
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Cd37
Name: CD37 antigen
Synonyms: Tspan26
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12493
HGNC: HGNC:1666
Homologene: 20422
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Msantd5f4
Name: Myb/SANT DNA binding domain containing 5 family member 4
Synonyms: Gm11236
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100862015
Homologene: 128423
Or4f14c
Name: olfactory receptor family 4 subfamily F member 14C
Synonyms: GA_x6K02T2Q125-73157028-73156524, MOR245-1, Olfr1315
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404497
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 36,701,453 bp
  • A to G, chromosome 1 at 44,087,976 bp
  • G to A, chromosome 1 at 75,315,685 bp
  • A to T, chromosome 1 at 87,597,243 bp
  • T to C, chromosome 1 at 92,597,256 bp
  • G to T, chromosome 1 at 134,184,181 bp
  • A to T, chromosome 1 at 136,260,288 bp
  • A to C, chromosome 2 at 76,719,108 bp
  • G to T, chromosome 2 at 76,787,251 bp
  • A to T, chromosome 2 at 104,762,947 bp
  • T to C, chromosome 2 at 112,111,096 bp
  • G to T, chromosome 2 at 120,745,430 bp
  • T to A, chromosome 2 at 128,158,301 bp
  • G to T, chromosome 2 at 136,069,134 bp
  • C to T, chromosome 2 at 152,143,770 bp
  • A to G, chromosome 3 at 59,329,247 bp
  • A to T, chromosome 3 at 83,354,186 bp
  • T to C, chromosome 3 at 102,946,111 bp
  • T to C, chromosome 3 at 123,671,900 bp
  • C to A, chromosome 4 at 34,551,148 bp
  • T to G, chromosome 4 at 46,468,592 bp
  • A to G, chromosome 4 at 73,638,948 bp
  • A to C, chromosome 4 at 84,291,901 bp
  • A to G, chromosome 4 at 91,311,610 bp
  • G to T, chromosome 4 at 105,049,403 bp
  • T to C, chromosome 4 at 141,632,421 bp
  • C to T, chromosome 4 at 152,038,376 bp
  • T to A, chromosome 5 at 45,695,798 bp
  • G to T, chromosome 5 at 73,607,924 bp
  • C to T, chromosome 5 at 73,607,925 bp
  • A to C, chromosome 5 at 90,263,275 bp
  • A to G, chromosome 5 at 103,867,843 bp
  • C to A, chromosome 5 at 104,518,952 bp
  • C to A, chromosome 5 at 146,845,297 bp
  • T to A, chromosome 6 at 3,373,493 bp
  • T to C, chromosome 6 at 48,765,325 bp
  • A to G, chromosome 6 at 113,763,605 bp
  • G to A, chromosome 6 at 115,585,364 bp
  • A to T, chromosome 6 at 118,165,927 bp
  • C to T, chromosome 7 at 25,686,037 bp
  • A to G, chromosome 7 at 30,876,024 bp
  • C to A, chromosome 7 at 45,237,198 bp
  • A to T, chromosome 7 at 105,692,726 bp
  • A to G, chromosome 7 at 121,742,343 bp
  • G to A, chromosome 7 at 123,983,457 bp
  • A to C, chromosome 7 at 133,671,478 bp
  • A to G, chromosome 7 at 143,460,227 bp
  • T to C, chromosome 8 at 11,448,198 bp
  • T to A, chromosome 8 at 34,817,191 bp
  • T to A, chromosome 8 at 105,887,201 bp
  • A to G, chromosome 8 at 110,653,237 bp
  • A to T, chromosome 8 at 110,983,596 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • TTATA to TTATATATA, chromosome 9 at 78,712,531 bp
  • G to A, chromosome 10 at 58,235,889 bp
  • G to A, chromosome 10 at 79,548,440 bp
  • A to T, chromosome 11 at 9,335,232 bp
  • T to G, chromosome 11 at 48,987,089 bp
  • C to A, chromosome 11 at 49,636,771 bp
  • G to A, chromosome 11 at 51,048,111 bp
  • T to C, chromosome 11 at 65,186,969 bp
  • C to T, chromosome 11 at 70,247,327 bp
  • A to T, chromosome 11 at 78,161,179 bp
  • G to T, chromosome 11 at 79,473,342 bp
  • T to A, chromosome 11 at 116,854,039 bp
  • T to C, chromosome 12 at 33,367,421 bp
  • T to C, chromosome 12 at 57,737,163 bp
  • T to A, chromosome 13 at 68,584,952 bp
  • C to T, chromosome 13 at 73,569,912 bp
  • T to A, chromosome 13 at 100,741,207 bp
  • T to A, chromosome 14 at 34,147,126 bp
  • A to G, chromosome 14 at 79,086,710 bp
  • A to C, chromosome 15 at 6,852,546 bp
  • T to C, chromosome 15 at 27,732,684 bp
  • A to G, chromosome 15 at 38,002,259 bp
  • T to A, chromosome 15 at 101,817,882 bp
  • C to T, chromosome 15 at 102,217,924 bp
  • G to T, chromosome 16 at 20,609,015 bp
  • A to T, chromosome 16 at 25,412,912 bp
  • C to A, chromosome 16 at 30,309,158 bp
  • T to G, chromosome 16 at 36,510,052 bp
  • T to A, chromosome 17 at 22,006,584 bp
  • G to A, chromosome 17 at 52,834,614 bp
  • T to A, chromosome 17 at 66,555,869 bp
  • T to C, chromosome 17 at 70,844,887 bp
  • G to T, chromosome 17 at 80,408,294 bp
  • C to A, chromosome 17 at 86,120,687 bp
  • T to C, chromosome 18 at 43,329,749 bp
  • T to C, chromosome 18 at 54,899,194 bp
  • T to C, chromosome 18 at 58,900,976 bp
  • G to T, chromosome 19 at 3,630,156 bp
  • T to C, chromosome 19 at 4,923,144 bp
  • C to T, chromosome 19 at 48,206,370 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9051 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068877-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.