Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9082Btlr/Mmmh
Stock Number:
068901-MU
Citation ID:
RRID:MMRRC_068901-MU
Other Names:
R9082 (G1)
Major Collection:

Strain Information

Cdk4
Name: cyclin dependent kinase 4
Synonyms: p34PSK-J3/cdk4, Crk3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Pomt1
Name: protein-O-mannosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99011
HGNC: HGNC:9202
Homologene: 68548
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Smg7
Name: SMG7 nonsense mediated mRNA decay factor
Synonyms: 9430023P16Rik, Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226517
Homologene: 32235
Fbxo31
Name: F-box protein 31
Synonyms: 2310046N15Rik, Fbx14, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Zc3h13
Name: zinc finger CCCH type containing 13
Synonyms: C87618, 4930570G11Rik, 2600010B19Rik, 3110050K21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67302
VEGA: 14
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: Nil2, [delta]EF1, MEB1, Tcf8, Zfx1a, Tcf18, AREB6, ZEB, Zfhep, 3110032K11Rik, Zfhx1a, Tw
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21417
Homologene: 31779
Itgb2
Name: integrin beta 2
Synonyms: Mac-1 beta, 2E6, Cd18
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16414
HGNC: HGNC:6155
Homologene: 20092
Gskip
Name: GSK3B interacting protein
Synonyms: 4933433P14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66787
VEGA: 12
Homologene: 9522
Tsc22d4
Name: Tsc22 domain family, member 4
Synonyms: Thg-1pit, 0610009M14Rik, 1700023B23Rik, Tsc22d4, Spacdr
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78829
Homologene: 11390
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, NKF3 kinase family member, C230081A13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244895
Homologene: 18259
Clu
Name: clusterin
Synonyms: testosterone repressed prostate message-2, SP-40, complement lysis inhibitor, Sgp-2, ApoJ, Apolipoprotein J, Cli, Sugp-2, Sgp2, D14Ucla3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12759
HGNC: HGNC:2095
Homologene: 1382
Ncoa1
Name: nuclear receptor coactivator 1
Synonyms: SRC-a/NCoA-1, SRC-1, SRC1, steroid receptor coactivator-1, KAT13A, bHLHe74
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17977
VEGA: 12
HGNC: HGNC:7668
Homologene: 7859
Optn
Name: optineurin
Synonyms: 4930441O07Rik, TFIIIA-INTP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71648
Homologene: 11085
Dhodh
Name: dihydroorotate dehydrogenase
Synonyms: 2810417D19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56749
HGNC: HGNC:2867
Homologene: 1043
Ctu2
Name: cytosolic thiouridylase subunit 2
Synonyms: 2310061F22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66965
Homologene: 79815
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Afm
Name: afamin
Synonyms: Alf, alpha albumin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 280662
HGNC: HGNC:316
Homologene: 881
Cpne2
Name: copine II
Synonyms: 3322401K10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234577
HGNC: HGNC:2315
Homologene: 27392
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Eif3m
Name: eukaryotic translation initiation factor 3, subunit M
Synonyms: Pcid1, Ga17, Tango7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98221
Homologene: 4639
Or6d13
Name: olfactory receptor family 6 subfamily D member 13
Synonyms: GA_x54KRFPKN04-58174409-58175392, MOR119-3, Olfr213
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258020
Homologene: 74186
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Pcdhb22
Name: protocadherin beta 22
Synonyms: Pcdhb15, PcdhbV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93893
HGNC: HGNC:8686
Homologene: 113752
Agap2
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
Vmn2r83
Name: vomeronasal 2, receptor 83
Synonyms: EG625029
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625029
Homologene: 83669
Gys1
Name: glycogen synthase 1, muscle
Synonyms: Gys3, MGS
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14936
HGNC: HGNC:4706
Homologene: 113557
Krt84
Name: keratin 84
Synonyms: HRb-1, Krt2-3, Krt2-16
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16680
VEGA: 15
HGNC: HGNC:6461
Homologene: 22473
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: semaphorin cytoplasmic domain-associated protein 3A, 1110020C07Rik, LNX3, Semcap3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55983
Homologene: 10328
Slc6a20a
Name: solute carrier family 6 (neurotransmitter transporter), member 20A
Synonyms: A730081N20Rik, Xtrp3s1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102680
Homologene: 10625
Kcnh7
Name: potassium voltage-gated channel, subfamily H (eag-related), member 7
Synonyms: Kv11.3, erg3, 9330137I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170738
Homologene: 13249
Mul1
Name: mitochondrial ubiquitin ligase activator of NFKB 1
Synonyms: 0610009K11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68350
Homologene: 11576
Col5a1
Name: collagen, type V, alpha 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12831
HGNC: HGNC:2209
Homologene: 55434
Gcnt1
Name: glucosaminyl (N-acetyl) transferase 1, core 2
Synonyms: IGnT, beta-1, 6-N-acetylglucosaminyltransferase, 5630400D21Rik, C2 GlcNAcT
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14537
HGNC: HGNC:4203
Homologene: 37486
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Grk5
Name: G protein-coupled receptor kinase 5
Synonyms: Gprk5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14773
VEGA: 19
HGNC: HGNC:4544
Homologene: 3879
Slc5a7
Name: solute carrier family 5 (choline transporter), member 7
Synonyms: CHT1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63993
VEGA: 17
Homologene: 32516
Zfp184
Name: zinc finger protein 184 (Kruppel-like)
Synonyms: 4930500C15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 193452
Homologene: 113602
Negr1
Name: neuronal growth regulator 1
Synonyms: Ntra, 5330422G01Rik, neurotractin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320840
Homologene: 41447
Ftdc1
Name: ferritin domain containing 1
Synonyms: LOC328695, LOC385656, Gm813
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 328695
VEGA: 16
Nsun5
Name: NOL1/NOP2/Sun domain family, member 5
Synonyms: Nol1r, 9830109N13Rik, Wbscr20a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100609
Homologene: 6828
Gm11011
Name: predicted gene 11011
Type: Gene
Species: Mouse
Chromosome: 2
Or5k15
Name: olfactory receptor family 5 subfamily J member 15
Synonyms: GA_x54KRFPKG5P-55108059-55107100, MOR184-6, Olfr178
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258999
Homologene: 79412
Apol11b
Name: apolipoprotein L 11b
Synonyms: A330102K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328563
Homologene: 129975
Slc37a4
Name: solute carrier family 37 (glucose-6-phosphate transporter), member 4
Synonyms: G6pt1, G6PT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14385
VEGA: 9
HGNC: HGNC:4061
Homologene: 37482
Ankrd22
Name: ankyrin repeat domain 22
Synonyms: 5430429D21Rik, D19Ertd675e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52024
Homologene: 34920
Zfp551
Name: zinc finger protein 551
Synonyms: 9630004E07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 619331
Homologene: 64631
Lrrc26
Name: leucine rich repeat containing 26
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227618
Homologene: 16228
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 44,060,714 bp
  • A to T, chromosome 1 at 152,840,177 bp
  • A to C, chromosome 2 at 5,054,640 bp
  • T to A, chromosome 2 at 25,290,332 bp
  • T to C, chromosome 2 at 27,962,110 bp
  • A to C, chromosome 2 at 32,252,961 bp
  • A to G, chromosome 2 at 62,777,534 bp
  • A to T, chromosome 2 at 105,005,872 bp
  • G to T, chromosome 2 at 169,584,504 bp
  • A to G, chromosome 3 at 93,395,621 bp
  • C to T, chromosome 3 at 142,303,402 bp
  • C to A, chromosome 3 at 157,069,239 bp
  • T to C, chromosome 4 at 53,720,010 bp
  • G to A, chromosome 4 at 117,105,100 bp
  • T to C, chromosome 4 at 138,439,634 bp
  • G to T, chromosome 5 at 90,550,236 bp
  • T to C, chromosome 5 at 135,373,974 bp
  • T to C, chromosome 5 at 137,751,247 bp
  • C to T, chromosome 6 at 101,169,133 bp
  • G to A, chromosome 6 at 116,541,008 bp
  • T to C, chromosome 7 at 12,417,077 bp
  • C to A, chromosome 7 at 45,439,493 bp
  • A to C, chromosome 8 at 94,568,609 bp
  • G to T, chromosome 8 at 109,596,102 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • T to C, chromosome 8 at 122,477,213 bp
  • A to C, chromosome 8 at 125,887,014 bp
  • A to G, chromosome 9 at 44,401,719 bp
  • A to T, chromosome 9 at 56,258,220 bp
  • A to G, chromosome 9 at 123,678,767 bp
  • T to C, chromosome 10 at 77,548,669 bp
  • C to T, chromosome 10 at 79,469,060 bp
  • T to A, chromosome 10 at 127,064,863 bp
  • A to G, chromosome 10 at 127,083,042 bp
  • A to T, chromosome 11 at 59,012,786 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • G to A, chromosome 12 at 3,772,740 bp
  • C to T, chromosome 12 at 4,296,106 bp
  • G to A, chromosome 12 at 105,698,750 bp
  • T to A, chromosome 13 at 21,959,466 bp
  • G to T, chromosome 14 at 31,177,374 bp
  • T to C, chromosome 14 at 65,979,704 bp
  • CAGAGACCGGGACAGAAGGAGAGAC to CAGAGAC, chromosome 14 at 75,331,941 bp
  • C to T, chromosome 15 at 77,640,571 bp
  • C to T, chromosome 15 at 101,532,379 bp
  • T to C, chromosome 16 at 58,616,931 bp
  • C to T, chromosome 16 at 58,889,471 bp
  • T to A, chromosome 16 at 81,615,772 bp
  • A to G, chromosome 17 at 54,297,111 bp
  • A to G, chromosome 17 at 58,330,340 bp
  • C to T, chromosome 18 at 5,772,557 bp
  • A to G, chromosome 18 at 37,519,994 bp
  • G to T, chromosome 19 at 17,330,195 bp
  • A to T, chromosome 19 at 34,149,262 bp
  • T to C, chromosome 19 at 61,046,129 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9082 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068901-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text