Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9084Btlr/Mmmh
Stock Number:
068903-MU
Citation ID:
RRID:MMRRC_068903-MU
Other Names:
R9084 (G1)
Major Collection:

Strain Information

Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Washc4
Name: WASH complex subunit 4
Synonyms: A230046K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319277
VEGA: 10
Homologene: 123926
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Med15
Name: mediator complex subunit 15
Synonyms: A230074L19Rik, Pcqap
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94112
VEGA: 16
Hspb8
Name: heat shock protein 8
Synonyms: HSP20-like, HSP22, D5Ucla4, E2IG1, H11, Cryac, H11K
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80888
Homologene: 8654
Git2
Name: GIT ArfGAP 2
Synonyms: Cool associated tyrosine phosphorylated-2, Cat-2, ARF GTPase activating protein 2, 5830420E16Rik, B230104M05Rik, 1500036H07Rik, 9630056M03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Pvr
Name: poliovirus receptor
Synonyms: mE4, 3830421F03Rik, Taa1, CD155, Tage4, necl-5, D7Ertd458e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52118
HGNC: HGNC:9705
Homologene: 79541
Unc13d
Name: unc-13 homolog D
Synonyms: Munc13-4, 2610108D09Rik, Jinx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Tmprss6
Name: transmembrane serine protease 6
Synonyms: matriptase-2, 1300008A22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71753
VEGA: 15
Homologene: 12408
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226432
Homologene: 5874
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Med13
Name: mediator complex subunit 13
Synonyms: Trap240, 1110067M05Rik, Thrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327987
Homologene: 21067
Gm4924
Name: predicted gene 4924
Synonyms: mIF1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237412
Pcx
Name: pyruvate carboxylase
Synonyms: Pc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18563
VEGA: 19
HGNC: HGNC:8636
Homologene: 5422
Ptprm
Name: protein tyrosine phosphatase receptor type M
Synonyms: RPTPmu
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19274
VEGA: 17
HGNC: HGNC:9675
Homologene: 37694
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218440
Homologene: 18450
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
C1qtnf6
Name: C1q and tumor necrosis factor related protein 6
Synonyms: 2810036M19Rik, CTRP6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72709
Homologene: 12481
Mfsd2a
Name: MFSD2 lysolipid transporter A, lysophospholipid
Synonyms: major facilitator superfamily domain containing 2A, 1700018O18Rik, Mfsd2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76574
Homologene: 19229
Ncoa2
Name: nuclear receptor coactivator 2
Synonyms: TIF2/GRIP-1, Grip1, D1Ertd433e, glucocorticoid receptor-interacting protein 1, TIF2, TIF-2, SRC-2, KAT13C, bHLHe75
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17978
HGNC: HGNC:7669
Homologene: 4768
Reck
Name: reversion-inducing-cysteine-rich protein with kazal motifs
Synonyms: St15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53614
Homologene: 9622
Uncx
Name: UNC homeobox
Synonyms: Chx4, Uncx4.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22255
Homologene: 56598
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Spata31d1c
Name: spermatogenesis associated 31 subfamily D, member 1C
Synonyms: Fam75d1c, 4932441B19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238683
VEGA: 13
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Tmem116
Name: transmembrane protein 116
Synonyms: 4930513P12Rik, 4930406A18Rik, C030022K24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77462
Homologene: 12676
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Xkr9
Name: X-linked Kx blood group related 9
Synonyms: LOC381246
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381246
Homologene: 20056
Snx25
Name: sorting nexin 25
Synonyms: LOC382008, SBBI31
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102141
Homologene: 23744
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, CARDIAK, RIP2, RICK, CARD3, D4Bwg0615e, 2210420D18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192656
Homologene: 37856
Or8g33
Name: olfactory receptor family 8 subfamily G member 33
Synonyms: GA_x6K02T2PVTD-33124064-33123120, MOR171-21, Olfr952
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235248
VEGA: 9
Homologene: 133698
Or6d15
Name: olfactory receptor family 6 subfamily D member 15
Synonyms: GA_x54KRFPKN04-58217732-58216800, MOR119-2, Olfr215
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258438
Homologene: 133693
Or4f7
Name: olfactory receptor family 4 subfamily F member 7
Synonyms: GA_x6K02T2N82Q-3465-3764, GA_x6K02T2Q125-72882187-72881249, MOR245-28_p, MOR245-7, MOR245-7, Olfr276, Olfr1303
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258397
Homologene: 88429
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Tubb1
Name: tubulin, beta 1 class VI
Synonyms: 2810484G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545486
Homologene: 69474
Fyn
Name: Fyn proto-oncogene
Synonyms: Src Kinase p59
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14360
HGNC: HGNC:4037
Homologene: 48068
Atp1b2
Name: ATPase, Na+/K+ transporting, beta 2 polypeptide
Synonyms: Atpb-2, Amog
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11932
HGNC: HGNC:805
Homologene: 36075
Nfe2l1
Name: nuclear factor, erythroid derived 2,-like 1
Synonyms: TCF-11, NRF1, LCR-F1, TCF11, Lcrf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18023
HGNC: HGNC:7781
Homologene: 20685
Sting1
Name: stimulator of interferon response cGAMP interactor 1
Synonyms: 2610307O08Rik, MPYS, ERIS, Sting, Tmem173
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72512
VEGA: 18
Homologene: 18868
Arhgap9
Name: Rho GTPase activating protein 9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216445
VEGA: 10
Homologene: 13041
Adam21
Name: a disintegrin and metallopeptidase domain 21
Synonyms: ADAM31
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56622
HGNC: HGNC:200
Homologene: 68365
Skint8
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639774
Homologene: 106613
Or6c69c
Name: olfactory receptor family 6 subfamily C member 69C
Synonyms: GA_x6K02T2PULF-11745102-11746040, MOR113-2, Olfr822
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258666
Homologene: 133890
Nid1
Name: nidogen 1
Synonyms: entactin, entactin 1, nidogen-1, entactin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Fam163a
Name: family with sequence similarity 163, member A
Synonyms: A230106N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329274
Homologene: 18306
Or4k15b
Name: olfactory receptor family 4 subfamily K member 15B
Synonyms: GA_x6K02T2PMLR-5725741-5724776, MOR246-3, MOR246-7_p, Olfr725
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258314
Homologene: 44957
Tlcd5
Name: TLC domain containing 5
Synonyms: LOC235300, Tmem136
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235300
VEGA: 9
Homologene: 72560
Mrpl9
Name: mitochondrial ribosomal protein L9
Synonyms: C330013D18Rik, 8030480E20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78523
Homologene: 12696
Slamf1
Name: signaling lymphocytic activation molecule family member 1
Synonyms: IPO-3, CD150, ESTM51, CDw150, Slam
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27218
Homologene: 48162
4930590J08Rik
Name: RIKEN cDNA 4930590J08 gene
Synonyms: LOC381798
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381798
Homologene: 49985
Cyp2a12
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13085
Homologene: 69128
Dusp6
Name: dual specificity phosphatase 6
Synonyms: 1300019I03Rik, MKP3, PYST1, MKP-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67603
VEGA: 10
HGNC: HGNC:3072
Homologene: 55621
Kcnn1
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Synonyms: SK1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 84036
HGNC: HGNC:6290
Homologene: 37595
Or1f19
Name: olfactory receptor family 1 subfamily F member 19
Synonyms: MOR131-1, GA_x54KRFPKG5P-112942-113883, Olfr161
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258859
Homologene: 51784
Fer1l5
Name: fer-1 like family member 5
Synonyms: 4930533C12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100534273
Homologene: 85232
Gm21698
Name: predicted gene, 21698
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862388
Homologene: 69402
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 13,174,429 bp
  • G to A, chromosome 1 at 13,672,509 bp
  • A to G, chromosome 1 at 36,390,538 bp
  • T to C, chromosome 1 at 135,406,825 bp
  • T to A, chromosome 1 at 156,079,984 bp
  • A to T, chromosome 1 at 171,774,954 bp
  • A to G, chromosome 2 at 76,782,378 bp
  • A to G, chromosome 2 at 111,814,651 bp
  • T to A, chromosome 2 at 174,457,404 bp
  • T to A, chromosome 3 at 94,447,251 bp
  • T to C, chromosome 4 at 16,123,795 bp
  • A to G, chromosome 4 at 43,922,809 bp
  • A to G, chromosome 4 at 111,937,013 bp
  • T to C, chromosome 4 at 122,950,201 bp
  • T to A, chromosome 5 at 25,985,246 bp
  • A to G, chromosome 5 at 34,605,842 bp
  • G to T, chromosome 5 at 114,764,454 bp
  • A to G, chromosome 5 at 116,422,433 bp
  • A to G, chromosome 5 at 121,489,324 bp
  • T to C, chromosome 5 at 139,543,998 bp
  • A to G, chromosome 6 at 91,915,035 bp
  • T to C, chromosome 6 at 114,701,935 bp
  • C to T, chromosome 6 at 116,582,271 bp
  • G to T, chromosome 7 at 19,917,012 bp
  • T to C, chromosome 7 at 27,036,519 bp
  • T to C, chromosome 8 at 16,088,311 bp
  • T to C, chromosome 8 at 46,068,166 bp
  • GTCCTCCTCCTCCTCCTCCTC to GTCCTCCTCCTCCTCCTC, chromosome 8 at 70,855,166 bp
  • C to T, chromosome 8 at 123,130,212 bp
  • A to T, chromosome 9 at 39,426,225 bp
  • C to T, chromosome 9 at 43,111,369 bp
  • T to C, chromosome 9 at 44,828,833 bp
  • T to A, chromosome 10 at 5,339,240 bp
  • C to T, chromosome 10 at 39,526,849 bp
  • T to C, chromosome 10 at 69,951,049 bp
  • T to C, chromosome 10 at 76,399,992 bp
  • T to A, chromosome 10 at 82,378,119 bp
  • T to C, chromosome 10 at 83,586,635 bp
  • T to C, chromosome 10 at 99,263,830 bp
  • T to C, chromosome 10 at 127,322,245 bp
  • A to T, chromosome 10 at 130,075,072 bp
  • G to C, chromosome 10 at 130,075,100 bp
  • T to C, chromosome 11 at 69,601,562 bp
  • A to G, chromosome 11 at 86,300,795 bp
  • A to T, chromosome 11 at 96,820,131 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • T to C, chromosome 12 at 81,559,386 bp
  • T to C, chromosome 13 at 11,601,838 bp
  • T to C, chromosome 13 at 13,478,340 bp
  • A to G, chromosome 13 at 65,035,145 bp
  • A to T, chromosome 13 at 67,259,569 bp
  • T to A, chromosome 13 at 92,439,212 bp
  • T to C, chromosome 14 at 50,034,459 bp
  • T to C, chromosome 15 at 71,820,080 bp
  • C to T, chromosome 15 at 78,454,217 bp
  • T to C, chromosome 15 at 78,525,083 bp
  • A to T, chromosome 15 at 91,750,266 bp
  • T to G, chromosome 16 at 3,592,753 bp
  • T to C, chromosome 16 at 17,653,208 bp
  • A to C, chromosome 17 at 66,956,953 bp
  • A to T, chromosome 18 at 35,736,102 bp
  • A to G, chromosome 19 at 4,619,840 bp
  • A to G, chromosome 19 at 17,120,377 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9084 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068903-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.