Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9084Btlr/Mmmh
Stock Number:
068903-MU
Citation ID:
RRID:MMRRC_068903-MU
Other Names:
R9084 (G1)
Major Collection:

Strain Information

Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Washc4
Name: WASH complex subunit 4
Synonyms: A230046K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319277
VEGA: 10
Homologene: 123926
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Med15
Name: mediator complex subunit 15
Synonyms: A230074L19Rik, Pcqap
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94112
VEGA: 16
Hspb8
Name: heat shock protein 8
Synonyms: HSP22, HSP20-like, D5Ucla4, E2IG1, H11, Cryac, H11K
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80888
Homologene: 8654
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 13,174,429 bp
  • G to A, chromosome 1 at 13,672,509 bp
  • A to G, chromosome 1 at 36,390,538 bp
  • T to C, chromosome 1 at 135,406,825 bp
  • T to A, chromosome 1 at 156,079,984 bp
  • A to T, chromosome 1 at 171,774,954 bp
  • A to G, chromosome 2 at 76,782,378 bp
  • A to G, chromosome 2 at 111,814,651 bp
  • T to A, chromosome 2 at 174,457,404 bp
  • T to A, chromosome 3 at 94,447,251 bp
  • T to C, chromosome 4 at 16,123,795 bp
  • A to G, chromosome 4 at 43,922,809 bp
  • A to G, chromosome 4 at 111,937,013 bp
  • T to C, chromosome 4 at 122,950,201 bp
  • T to A, chromosome 5 at 25,985,246 bp
  • A to G, chromosome 5 at 34,605,842 bp
  • G to T, chromosome 5 at 114,764,454 bp
  • A to G, chromosome 5 at 116,422,433 bp
  • A to G, chromosome 5 at 121,489,324 bp
  • T to C, chromosome 5 at 139,543,998 bp
  • A to G, chromosome 6 at 91,915,035 bp
  • T to C, chromosome 6 at 114,701,935 bp
  • C to T, chromosome 6 at 116,582,271 bp
  • G to T, chromosome 7 at 19,917,012 bp
  • T to C, chromosome 7 at 27,036,519 bp
  • T to C, chromosome 8 at 16,088,311 bp
  • T to C, chromosome 8 at 46,068,166 bp
  • GTCCTCCTCCTCCTCCTCCTC to GTCCTCCTCCTCCTCCTC, chromosome 8 at 70,855,166 bp
  • C to T, chromosome 8 at 123,130,212 bp
  • A to T, chromosome 9 at 39,426,225 bp
  • C to T, chromosome 9 at 43,111,369 bp
  • T to C, chromosome 9 at 44,828,833 bp
  • T to A, chromosome 10 at 5,339,240 bp
  • C to T, chromosome 10 at 39,526,849 bp
  • T to C, chromosome 10 at 69,951,049 bp
  • T to C, chromosome 10 at 76,399,992 bp
  • T to A, chromosome 10 at 82,378,119 bp
  • T to C, chromosome 10 at 83,586,635 bp
  • T to C, chromosome 10 at 99,263,830 bp
  • T to C, chromosome 10 at 127,322,245 bp
  • A to T, chromosome 10 at 130,075,072 bp
  • G to C, chromosome 10 at 130,075,100 bp
  • T to C, chromosome 11 at 69,601,562 bp
  • A to G, chromosome 11 at 86,300,795 bp
  • A to T, chromosome 11 at 96,820,131 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • T to C, chromosome 12 at 81,559,386 bp
  • T to C, chromosome 13 at 11,601,838 bp
  • T to C, chromosome 13 at 13,478,340 bp
  • A to G, chromosome 13 at 65,035,145 bp
  • A to T, chromosome 13 at 67,259,569 bp
  • T to A, chromosome 13 at 92,439,212 bp
  • T to C, chromosome 14 at 50,034,459 bp
  • T to C, chromosome 15 at 71,820,080 bp
  • C to T, chromosome 15 at 78,454,217 bp
  • T to C, chromosome 15 at 78,525,083 bp
  • A to T, chromosome 15 at 91,750,266 bp
  • T to G, chromosome 16 at 3,592,753 bp
  • T to C, chromosome 16 at 17,653,208 bp
  • A to C, chromosome 17 at 66,956,953 bp
  • A to T, chromosome 18 at 35,736,102 bp
  • A to G, chromosome 19 at 4,619,840 bp
  • A to G, chromosome 19 at 17,120,377 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9084 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068903-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.