Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9092Btlr/Mmmh
Stock Number:
068908-MU
Citation ID:
RRID:MMRRC_068908-MU
Other Names:
R9092 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Drd2
Name: dopamine receptor D2
Synonyms: D2 receptor, D2R, Drd-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
E2f7
Name: E2F transcription factor 7
Synonyms: A630014C11Rik, D10Ertd739e, E2F7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52679
Homologene: 18685
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Map2k4
Name: mitogen-activated protein kinase kinase 4
Synonyms: MKK4, JNKK1, Serk1, Sek1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26398
HGNC: HGNC:6844
Homologene: 48159
Cux1
Name: cut-like homeobox 1
Synonyms: Cux, CDP, Cux-1, Cutl1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13047
HGNC: HGNC:2557
Tmem161b
Name: transmembrane protein 161B
Synonyms: 2810446P07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72745
Homologene: 14519
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Il7r
Name: interleukin 7 receptor
Synonyms: IL-7 receptor alpha chain, CD127, IL-7Ralpha
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16197
VEGA: 15
HGNC: HGNC:6024
Homologene: 1646
Flvcr1
Name: feline leukemia virus subgroup C cellular receptor 1
Synonyms: 9630055N22Rik, Mfsd7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226844
Homologene: 56661
Runx2
Name: runt related transcription factor 2
Synonyms: AML3, polyomavirus enhancer binding factor 2 (PEBP2), SL3-3 enhancer factor 1, PEBP2 alpha A, PEBP2aA, Osf2, Cbfa1, Pebpa2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12393
Homologene: 68389
Tpbg
Name: trophoblast glycoprotein
Synonyms: 5T4, 5T4 oncofetal antigen
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21983
Homologene: 4859
Lrrc47
Name: leucine rich repeat containing 47
Synonyms: 2900010D03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72946
Homologene: 10795
Noc3l
Name: NOC3 like DNA replication regulator
Synonyms: Fad24
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 57753
VEGA: 19
Homologene: 39642
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Pax1
Name: paired box 1
Synonyms: wt, hbs, Pax-1, hunchback, wavy tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18503
HGNC: HGNC:8615
Homologene: 4514
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Mmrn2
Name: multimerin 2
Synonyms: EndoGlyx-1, ENDOGLYX1, Emilin3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105450
VEGA: 14
Homologene: 11697
Wdr11
Name: WD repeat domain 11
Synonyms: 2900055P10Rik, Wdr11, Brwd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207425
Homologene: 41229
Zfp608
Name: zinc finger protein 608
Synonyms: 4932417D18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269023
VEGA: 18
Homologene: 18485
Pdzph1
Name: PDZ and pleckstrin homology domains 1
Synonyms: 2610034M16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69239
Homologene: 130756
Liat1
Name: ligand of ATE1
Synonyms: 1700016K19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74230
Homologene: 52371
Ephb3
Name: Eph receptor B3
Synonyms: Sek4, MDK5, HEK2, Etk2, Tyro6, Cek10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13845
HGNC: HGNC:3394
Homologene: 20938
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Chl1
Name: cell adhesion molecule L1-like
Synonyms: CALL, A530023M13Rik, close homolog of L1, LICAM2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12661
HGNC: HGNC:1939
Homologene: 21314
F13a1
Name: coagulation factor XIII, A1 subunit
Synonyms: Factor XIIIA, 1200014I03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74145
VEGA: 13
HGNC: HGNC:3531
Homologene: 20077
Pam
Name: peptidylglycine alpha-amidating monooxygenase
Synonyms: PHM
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18484
HGNC: HGNC:8596
Homologene: 37369
Tmem30a
Name: transmembrane protein 30A
Synonyms: 2010200I23Rik, D9Wsu20e, Cdc50a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69981
Homologene: 110703
Slc27a6
Name: solute carrier family 27 (fatty acid transporter), member 6
Synonyms: FATP6, 4732438L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225579
Homologene: 38385
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Gjb3
Name: gap junction protein, beta 3
Synonyms: Cnx31, connexin 31, Gjb-3, D4Wsu144e, Cx31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14620
HGNC: HGNC:4285
Homologene: 7338
Tmprss11c
Name: transmembrane protease, serine 11c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435845
Homologene: 78847
Sh3tc1
Name: SH3 domain and tetratricopeptide repeats 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231147
Homologene: 10360
Galnt15
Name: polypeptide N-acetylgalactosaminyltransferase 15
Synonyms: 4631401E18Rik, Galntl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78754
Homologene: 14286
Pag1
Name: phosphoprotein associated with glycosphingolipid microdomains 1
Synonyms: F730007C19Rik, Cbp
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94212
Homologene: 10198
Vmn2r101
Name: vomeronasal 2, receptor 101
Synonyms: EG627576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627576
Homologene: 115024
Vmn1r66
Name: vomeronasal 1 receptor 66
Synonyms: V1re11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171264
Vps16
Name: VSP16 CORVET/HOPS core subunit
Synonyms: 1810074M16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80743
Homologene: 7116
Sorbs3
Name: sorbin and SH3 domain containing 3
Synonyms: SH3P3, vinexin alpha, vinexin beta, Sh3d4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20410
VEGA: 14
Homologene: 4218
Fam216b
Name: family with sequence similarity 216, member B
Synonyms: AU021034
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219170
Homologene: 52240
Crtc3
Name: CREB regulated transcription coactivator 3
Synonyms: 6332415K15Rik, 2610312F20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70461
Homologene: 11248
Gab3
Name: growth factor receptor bound protein 2-associated protein 3
Synonyms: 5930433H21Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 210710
Homologene: 15417
Pofut1
Name: protein O-fucosyltransferase 1
Synonyms: O-FucT-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140484
Homologene: 9104
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Or4p8
Name: olfactory receptor family 4 subfamily P member 8
Synonyms: GA_x6K02T2Q125-50372411-50371485, MOR225-4, Olfr1208
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258774
Homologene: 74190
Dcun1d2
Name: defective in cullin neddylation 1 domain containing 2
Synonyms: DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102323
Homologene: 85990
Phlda1
Name: pleckstrin homology like domain, family A, member 1
Synonyms: TDAG51, DT1P1B11, Tdag
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21664
HGNC: HGNC:8933
Homologene: 7203
Serpina1b
Name: serine (or cysteine) preptidase inhibitor, clade A, member 1B
Synonyms: PI2, D12Ucla2, Spi1-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20701
HGNC: HGNC:8941
Homologene: 20103
Pcdhgb1
Name: protocadherin gamma subfamily B, 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93699
HGNC: HGNC:8708
Homologene: 81867
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,562,362 bp
  • G to A, chromosome 1 at 65,244,400 bp
  • A to G, chromosome 1 at 75,422,734 bp
  • A to G, chromosome 1 at 97,864,251 bp
  • A to T, chromosome 1 at 191,008,167 bp
  • T to C, chromosome 2 at 88,896,977 bp
  • T to C, chromosome 2 at 130,439,673 bp
  • T to G, chromosome 2 at 147,362,367 bp
  • T to G, chromosome 2 at 153,259,588 bp
  • T to C, chromosome 3 at 9,699,788 bp
  • GCCAGATGCGCCCA to GCCAGATGCGCCCAGATGCGCCCA, chromosome 4 at 127,326,665 bp
  • A to AGATGCGCCCG, chromosome 4 at 127,326,678 bp
  • C to A, chromosome 4 at 154,011,964 bp
  • T to C, chromosome 5 at 35,716,977 bp
  • T to C, chromosome 5 at 86,237,636 bp
  • A to G, chromosome 5 at 134,289,387 bp
  • T to A, chromosome 5 at 136,485,817 bp
  • T to C, chromosome 6 at 103,668,854 bp
  • T to A, chromosome 7 at 10,274,183 bp
  • T to C, chromosome 7 at 80,589,880 bp
  • T to A, chromosome 7 at 129,624,727 bp
  • G to A, chromosome 8 at 13,257,935 bp
  • G to T, chromosome 8 at 36,732,706 bp
  • A to T, chromosome 8 at 41,002,438 bp
  • A to G, chromosome 9 at 49,395,704 bp
  • T to C, chromosome 9 at 75,147,132 bp
  • T to C, chromosome 9 at 79,771,299 bp
  • T to C, chromosome 9 at 85,844,863 bp
  • A to T, chromosome 9 at 121,073,937 bp
  • GCCC to GCC, chromosome 10 at 58,231,122 bp
  • C to A, chromosome 10 at 88,768,817 bp
  • T to C, chromosome 10 at 88,775,318 bp
  • T to C, chromosome 10 at 110,781,013 bp
  • T to C, chromosome 10 at 111,506,613 bp
  • C to A, chromosome 11 at 65,690,773 bp
  • A to G, chromosome 11 at 76,003,061 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • T to A, chromosome 12 at 103,730,281 bp
  • T to G, chromosome 13 at 36,906,019 bp
  • C to A, chromosome 13 at 67,070,500 bp
  • C to T, chromosome 13 at 84,292,384 bp
  • T to C, chromosome 13 at 98,749,883 bp
  • A to G, chromosome 14 at 32,058,239 bp
  • T to C, chromosome 14 at 34,396,630 bp
  • C to T, chromosome 14 at 70,207,555 bp
  • T to C, chromosome 14 at 78,085,097 bp
  • T to A, chromosome 15 at 9,510,184 bp
  • T to G, chromosome 15 at 101,627,910 bp
  • G to A, chromosome 16 at 21,222,464 bp
  • T to A, chromosome 16 at 91,812,114 bp
  • A to T, chromosome 17 at 19,589,545 bp
  • G to T, chromosome 17 at 24,569,373 bp
  • C to A, chromosome 17 at 44,735,556 bp
  • T to C, chromosome 17 at 58,973,130 bp
  • T to A, chromosome 18 at 37,680,936 bp
  • A to G, chromosome 18 at 54,898,576 bp
  • C to A, chromosome 18 at 58,609,258 bp
  • T to A, chromosome 19 at 38,810,043 bp
  • TCT to TCTGCT, chromosome X at 74,999,996 bp
  • CTT to CTTGTT, chromosome X at 75,000,006 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9092 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068908-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.