Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9092Btlr/Mmmh
Stock Number:
068908-MU
Citation ID:
RRID:MMRRC_068908-MU
Other Names:
R9092 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Drd2
Name: dopamine receptor D2
Synonyms: D2 receptor, D2R, Drd-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,562,362 bp
  • G to A, chromosome 1 at 65,244,400 bp
  • A to G, chromosome 1 at 75,422,734 bp
  • A to G, chromosome 1 at 97,864,251 bp
  • A to T, chromosome 1 at 191,008,167 bp
  • T to C, chromosome 2 at 88,896,977 bp
  • T to C, chromosome 2 at 130,439,673 bp
  • T to G, chromosome 2 at 147,362,367 bp
  • T to G, chromosome 2 at 153,259,588 bp
  • T to C, chromosome 3 at 9,699,788 bp
  • GCCAGATGCGCCCA to GCCAGATGCGCCCAGATGCGCCCA, chromosome 4 at 127,326,665 bp
  • A to AGATGCGCCCG, chromosome 4 at 127,326,678 bp
  • C to A, chromosome 4 at 154,011,964 bp
  • T to C, chromosome 5 at 35,716,977 bp
  • T to C, chromosome 5 at 86,237,636 bp
  • A to G, chromosome 5 at 134,289,387 bp
  • T to A, chromosome 5 at 136,485,817 bp
  • T to C, chromosome 6 at 103,668,854 bp
  • T to A, chromosome 7 at 10,274,183 bp
  • T to C, chromosome 7 at 80,589,880 bp
  • T to A, chromosome 7 at 129,624,727 bp
  • G to A, chromosome 8 at 13,257,935 bp
  • G to T, chromosome 8 at 36,732,706 bp
  • A to T, chromosome 8 at 41,002,438 bp
  • A to G, chromosome 9 at 49,395,704 bp
  • T to C, chromosome 9 at 75,147,132 bp
  • T to C, chromosome 9 at 79,771,299 bp
  • T to C, chromosome 9 at 85,844,863 bp
  • A to T, chromosome 9 at 121,073,937 bp
  • GCCC to GCC, chromosome 10 at 58,231,122 bp
  • C to A, chromosome 10 at 88,768,817 bp
  • T to C, chromosome 10 at 88,775,318 bp
  • T to C, chromosome 10 at 110,781,013 bp
  • T to C, chromosome 10 at 111,506,613 bp
  • C to A, chromosome 11 at 65,690,773 bp
  • A to G, chromosome 11 at 76,003,061 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • T to A, chromosome 12 at 103,730,281 bp
  • T to G, chromosome 13 at 36,906,019 bp
  • C to A, chromosome 13 at 67,070,500 bp
  • C to T, chromosome 13 at 84,292,384 bp
  • T to C, chromosome 13 at 98,749,883 bp
  • A to G, chromosome 14 at 32,058,239 bp
  • T to C, chromosome 14 at 34,396,630 bp
  • C to T, chromosome 14 at 70,207,555 bp
  • T to C, chromosome 14 at 78,085,097 bp
  • T to A, chromosome 15 at 9,510,184 bp
  • T to G, chromosome 15 at 101,627,910 bp
  • G to A, chromosome 16 at 21,222,464 bp
  • T to A, chromosome 16 at 91,812,114 bp
  • A to T, chromosome 17 at 19,589,545 bp
  • G to T, chromosome 17 at 24,569,373 bp
  • C to A, chromosome 17 at 44,735,556 bp
  • T to C, chromosome 17 at 58,973,130 bp
  • T to A, chromosome 18 at 37,680,936 bp
  • A to G, chromosome 18 at 54,898,576 bp
  • C to A, chromosome 18 at 58,609,258 bp
  • T to A, chromosome 19 at 38,810,043 bp
  • TCT to TCTGCT, chromosome X at 74,999,996 bp
  • CTT to CTTGTT, chromosome X at 75,000,006 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9092 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068908-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.