Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9119Btlr/Mmmh
Stock Number:
068922-MU
Citation ID:
RRID:MMRRC_068922-MU
Other Names:
R9119 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
2310061I04Rik
Name: RIKEN cDNA 2310061I04 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69662
Homologene: 17027
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Usp38
Name: ubiquitin specific peptidase 38
Synonyms: 4631402N15Rik, 4833420O05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74841
Homologene: 12367
Sfswap
Name: splicing factor SWAP
Synonyms: 6330437E22Rik, 1190005N23Rik, Sfrs8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231769
Homologene: 134548
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 78,665,308 bp
  • G to T, chromosome 1 at 92,511,182 bp
  • T to A, chromosome 1 at 150,404,002 bp
  • T to G, chromosome 2 at 17,400,559 bp
  • G to A, chromosome 2 at 135,967,952 bp
  • T to C, chromosome 3 at 75,078,590 bp
  • C to T, chromosome 3 at 108,401,972 bp
  • T to A, chromosome 4 at 20,057,955 bp
  • G to A, chromosome 4 at 143,131,879 bp
  • A to G, chromosome 5 at 87,462,975 bp
  • T to A, chromosome 5 at 96,828,698 bp
  • C to A, chromosome 5 at 129,514,765 bp
  • G to A, chromosome 5 at 130,269,224 bp
  • T to A, chromosome 5 at 138,176,041 bp
  • A to T, chromosome 6 at 23,094,001 bp
  • T to C, chromosome 6 at 73,060,203 bp
  • A to T, chromosome 6 at 115,955,871 bp
  • C to T, chromosome 6 at 123,315,568 bp
  • T to A, chromosome 7 at 4,552,713 bp
  • T to G, chromosome 7 at 18,647,484 bp
  • T to C, chromosome 7 at 43,639,485 bp
  • T to C, chromosome 7 at 110,312,085 bp
  • A to G, chromosome 7 at 140,846,222 bp
  • G to A, chromosome 8 at 45,087,966 bp
  • C to T, chromosome 8 at 71,712,068 bp
  • A to G, chromosome 8 at 72,138,681 bp
  • A to T, chromosome 8 at 80,984,599 bp
  • A to G, chromosome 8 at 107,416,144 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 10 at 82,295,719 bp
  • T to G, chromosome 10 at 84,947,470 bp
  • T to C, chromosome 10 at 89,413,457 bp
  • G to A, chromosome 11 at 8,879,107 bp
  • T to A, chromosome 11 at 102,946,053 bp
  • A to T, chromosome 13 at 40,180,540 bp
  • A to G, chromosome 13 at 81,510,876 bp
  • A to G, chromosome 14 at 118,631,030 bp
  • C to A, chromosome 16 at 36,966,095 bp
  • C to T, chromosome 16 at 94,392,091 bp
  • C to G, chromosome 17 at 35,893,071 bp
  • T to A, chromosome 17 at 85,096,560 bp
  • T to C, chromosome 17 at 89,910,193 bp
  • G to A, chromosome 19 at 6,938,443 bp
  • A to T, chromosome 19 at 48,653,994 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9119 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068922-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.