Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9165Btlr/Mmmh
Stock Number:
068945-MU
Citation ID:
RRID:MMRRC_068945-MU
Other Names:
R9165 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Faf2
Name: Fas associated factor family member 2
Synonyms: 2210404D11Rik, Ubxd8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76577
Homologene: 8753
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230967
Homologene: 44919
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 66,549,841 bp
  • A to T, chromosome 1 at 88,055,787 bp
  • G to T, chromosome 1 at 131,816,087 bp
  • T to G, chromosome 1 at 133,272,637 bp
  • A to G, chromosome 1 at 191,163,061 bp
  • C to T, chromosome 2 at 26,423,633 bp
  • A to G, chromosome 2 at 76,713,006 bp
  • T to C, chromosome 2 at 104,788,470 bp
  • C to A, chromosome 2 at 121,331,564 bp
  • A to G, chromosome 2 at 127,884,512 bp
  • G to T, chromosome 2 at 154,009,821 bp
  • C to A, chromosome 2 at 180,179,493 bp
  • A to G, chromosome 3 at 15,574,904 bp
  • G to T, chromosome 3 at 15,990,896 bp
  • A to T, chromosome 3 at 56,004,868 bp
  • G to A, chromosome 3 at 58,545,274 bp
  • A to G, chromosome 3 at 65,383,100 bp
  • G to T, chromosome 3 at 122,276,706 bp
  • G to T, chromosome 3 at 139,309,232 bp
  • C to G, chromosome 4 at 21,679,659 bp
  • A to T, chromosome 4 at 84,411,494 bp
  • T to A, chromosome 4 at 118,808,998 bp
  • A to G, chromosome 4 at 143,132,104 bp
  • A to T, chromosome 4 at 145,701,454 bp
  • T to A, chromosome 4 at 153,994,514 bp
  • GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC to GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC, chromosome 5 at 77,281,804 bp
  • A to T, chromosome 5 at 87,694,559 bp
  • A to G, chromosome 5 at 114,216,683 bp
  • T to A, chromosome 5 at 147,615,237 bp
  • G to A, chromosome 6 at 52,208,555 bp
  • A to G, chromosome 6 at 57,432,261 bp
  • A to T, chromosome 6 at 66,732,070 bp
  • A to G, chromosome 6 at 73,144,941 bp
  • T to A, chromosome 6 at 124,811,538 bp
  • T to A, chromosome 6 at 128,560,669 bp
  • C to A, chromosome 7 at 11,679,024 bp
  • A to G, chromosome 7 at 44,959,501 bp
  • T to A, chromosome 7 at 45,819,644 bp
  • G to A, chromosome 7 at 80,274,686 bp
  • A to T, chromosome 7 at 86,465,617 bp
  • A to G, chromosome 7 at 98,454,064 bp
  • T to A, chromosome 8 at 3,745,602 bp
  • A to G, chromosome 8 at 9,972,394 bp
  • T to C, chromosome 8 at 13,039,564 bp
  • A to T, chromosome 9 at 7,114,883 bp
  • G to A, chromosome 9 at 120,018,236 bp
  • G to T, chromosome 9 at 123,568,956 bp
  • C to A, chromosome 10 at 24,101,602 bp
  • A to G, chromosome 10 at 27,053,026 bp
  • A to G, chromosome 10 at 41,433,239 bp
  • G to A, chromosome 10 at 79,920,771 bp
  • T to A, chromosome 10 at 94,181,603 bp
  • T to C, chromosome 11 at 23,615,244 bp
  • T to C, chromosome 11 at 57,185,933 bp
  • T to C, chromosome 11 at 106,567,269 bp
  • A to C, chromosome 11 at 115,344,598 bp
  • T to A, chromosome 12 at 84,650,477 bp
  • T to A, chromosome 12 at 85,030,568 bp
  • A to G, chromosome 12 at 88,027,307 bp
  • A to G, chromosome 13 at 54,652,138 bp
  • A to T, chromosome 13 at 113,100,921 bp
  • C to A, chromosome 14 at 24,146,241 bp
  • A to G, chromosome 14 at 44,989,778 bp
  • A to C, chromosome 14 at 52,018,642 bp
  • A to G, chromosome 14 at 52,285,790 bp
  • A to G, chromosome 14 at 52,490,373 bp
  • A to T, chromosome 14 at 56,948,007 bp
  • G to A, chromosome 14 at 66,917,123 bp
  • T to G, chromosome 15 at 58,873,745 bp
  • T to A, chromosome 16 at 96,176,018 bp
  • T to C, chromosome 17 at 48,037,548 bp
  • C to T, chromosome 17 at 57,080,734 bp
  • C to A, chromosome 17 at 57,311,895 bp
  • A to G, chromosome 18 at 35,317,846 bp
  • G to T, chromosome 18 at 36,533,623 bp
  • A to G, chromosome 18 at 49,878,925 bp
  • A to T, chromosome 19 at 5,982,851 bp
  • A to T, chromosome 19 at 12,209,922 bp
  • C to G, chromosome 19 at 56,538,369 bp
  • A to T, chromosome X at 145,461,749 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9165 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068945-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.