Strain Name:
C57BL/6J-MtgxR9165Btlr/Mmmh
Stock Number:
068945-MU
Citation ID:
RRID:MMRRC_068945-MU
Other Names:
R9165 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: NRSF, 2610008J04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, A930013E17Rik, Zap3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Faf2
Name: Fas associated factor family member 2
Synonyms: 2210404D11Rik, Ubxd8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76577
Homologene: 8753
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: LOC381568, KMT8, Riz, E330024L24Rik, 4833427P12Rik, Riz1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230967
Homologene: 44919
Sacm1l
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: SAC1, Sac1p
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83493
VEGA: 9
Homologene: 6320
Cpt1c
Name: carnitine palmitoyltransferase 1c
Synonyms: 9630004I06Rik, CPT I-C
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78070
Homologene: 17561
Sec16a
Name: SEC16 homolog A, endoplasmic reticulum export factor
Synonyms: C230052J16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227648
Homologene: 10533
Tex2
Name: testis expressed gene 2
Synonyms: Def-5, Taz4, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Zmym2
Name: zinc finger, MYM-type 2
Synonyms: RAMP, MYM, Zfp198, FIM, SCLL
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76007
VEGA: 14
Homologene: 12631
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Nr2c1
Name: nuclear receptor subfamily 2, group C, member 1
Synonyms: 4831444H07Rik, Tr2-11, Eenr, TR2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22025
HGNC: HGNC:7971
Homologene: 55731
Ssr3
Name: signal sequence receptor, gamma
Synonyms: Trap-gamma, 0610038P07Rik, translocon-associated protein gamma
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67437
Homologene: 5154
Dnttip2
Name: deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms: 4930588M11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99480
Homologene: 124162
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Zfp980
Name: zinc finger protein 980
Synonyms: Gm13242
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041379
Homologene: 133076
Tubb4a
Name: tubulin, beta 4A class IVA
Synonyms: Tubb, Tubb4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22153
VEGA: 17
Homologene: 55952
Csn2
Name: casein beta
Synonyms: Csnb, CSN2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12991
HGNC: HGNC:2447
Homologene: 1426
Lig4
Name: ligase IV, DNA, ATP-dependent
Synonyms: 5830471N16Rik, tiny, DNA ligase IV
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319583
HGNC: HGNC:6601
Homologene: 1736
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, b2b414Clo, Dnchc2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, m152Asp, m407Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Eif2a
Name: eukaryotic translation initiation factor 2A
Synonyms: D3Ertd194e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229317
HGNC: HGNC:3254
Homologene: 5969
Tox4
Name: TOX high mobility group box family member 4
Synonyms: 5730589K01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268741
Homologene: 8889
Sil1
Name: SIL1 nucleotide exchange factor
Synonyms: 1810057E01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 81500
VEGA: 18
Homologene: 32544
Qser1
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99003
Homologene: 11710
Cd209a
Name: CD209a antigen
Synonyms: DC-SIGN, CIRE, CD209, SIGNR5, Dcsign, DC-SIGN1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170786
Homologene: 129771
Kcnj14
Name: potassium inwardly-rectifying channel, subfamily J, member 14
Synonyms: Kir2.4, IRK4, A930026G01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211480
HGNC: HGNC:6260
Homologene: 27086
Ptger2
Name: prostaglandin E receptor 2 (subtype EP2)
Synonyms: EP2, Ptgerep2, EP2 receptor
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19217
HGNC: HGNC:9594
Homologene: 739
F10
Name: coagulation factor X
Synonyms: AI194738, Cf10, fX
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14058
HGNC: HGNC:3528
Homologene: 30976
Vav1
Name: vav 1 oncogene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22324
Homologene: 3961
Lama2
Name: laminin, alpha 2
Synonyms: mer, merosin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Vmn1r37
Name: vomeronasal 1 receptor 37
Synonyms: V1rc10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171183
Homologene: 110800
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Flt1
Name: FMS-like tyrosine kinase 1
Synonyms: vascular endothelial growth factor receptor-1, Flt-1, VEGFR1, VEGFR-1, sFlt1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14254
HGNC: HGNC:3763
Homologene: 134179
Gucy2d
Name: guanylate cyclase 2d
Synonyms: guanylyl cyclase D
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14918
Homologene: 71540
Slc4a9
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 9
Synonyms: D630024F24Rik, AE4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240215
VEGA: 18
Homologene: 23732
Vrtn
Name: vertebrae development associated
Synonyms: 7420416P09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432677
VEGA: 12
Homologene: 41236
Stpg2
Name: sperm tail PG rich repeat containing 2
Synonyms: LOC381476, B930007M17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381476
Homologene: 52167
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Ak9
Name: adenylate kinase 9
Synonyms: Akd2, LOC215946, Akd1, Gm7127
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
Or10ak12
Name: olfactory receptor family 10 subfamily AK member 12
Synonyms: Olfr1335, MOR259-5, GA_x6K02T2QD9B-18723799-18724749, Olfr1334-ps1, MOR259-12, GA_x6K02T2QD9B-18726774-18727577
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435804
Homologene: 138635
Vmn1r20
Name: vomeronasal 1 receptor 20
Synonyms: Gm5569
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434017
Homologene: 79462
Dclre1a
Name: DNA cross-link repair 1A
Synonyms: mSNM1, SMN1a, 2810043H12Rik, SNM1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 55947
Homologene: 8920
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: Glur-1, GluA1, 2900051M01Rik, GluR-A, GluR1, HIPA1, Glr1, Glur1, Glr-1, GluRA
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240753
Homologene: 135779
Kiss1r
Name: KISS1 receptor
Synonyms: Gpr54
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114229
VEGA: 10
HGNC: HGNC:4510
Homologene: 11411
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: Hisppd2a, B430315C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
Sanbr
Name: SANT and BTB domain regulator of CSR
Synonyms: 0610010F05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71675
Homologene: 19038
Trmt12
Name: tRNA methyltransferase 12
Synonyms: 4632406N01Rik, Tyw2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68260
VEGA: 15
Homologene: 32379
Garin4
Name: golgi associated RAB2 interactor family member 4
Synonyms: Fam71a, 4933417M04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 619288
Homologene: 77474
Vps33b
Name: vacuolar protein sorting 33B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233405
Homologene: 10261
Slc22a20
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: mOAT6, LOC381203
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381203
Homologene: 87203
Xirp1
Name: xin actin-binding repeat containing 1
Synonyms: Cmya1, mXin alpha, Xin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22437
VEGA: 9
Homologene: 7998
Vmn1r72
Name: vomeronasal 1 receptor 72
Synonyms: V1rg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252905
Homologene: 74318
Hoxa6
Name: homeobox A6
Synonyms: Hox-1.2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15403
HGNC: HGNC:5107
Homologene: 7765
Prdm13
Name: PR domain containing 13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230025
Homologene: 11000
Or5an9
Name: olfactory receptor family 5 subfamily AN member 9
Synonyms: Olfr1431, MOR214-5, GA_x6K02T2RE5P-2573738-2574676
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258409
Homologene: 115495
Lca5l
Name: Leber congenital amaurosis 5-like
Synonyms: 4921526F01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385668
HGNC: HGNC:1255
Homologene: 47978
Sirpb1b
Name: signal-regulatory protein beta 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668101
Homologene: 82993
Tpi1
Name: triosephosphate isomerase 1
Synonyms: Tpi-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21991
Homologene: 128432
Acoxl
Name: acyl-Coenzyme A oxidase-like
Synonyms: 1200014P05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74121
Homologene: 75083
Tmem253
Name: transmembrane protein 253
Synonyms: G630016D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 619301
VEGA: 14
Homologene: 83921
Ugt1a10
Name: UDP glycosyltransferase 1 family, polypeptide A10
Synonyms: A13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 394430
Homologene: 133281
Or4e5
Name: olfactory receptor family 4 subfamily E member 5
Synonyms: MOR244-1, MOR28, GA_x6K02T2RJGY-491851-492792, Olfr1507
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57269
HGNC: HGNC:8296
Homologene: 10736
Taar8c
Name: trace amine-associated receptor 8C
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 494546
Homologene: 77586
Gzma
Name: granzyme A
Synonyms: TSP-1, SE1, H factor, Ctla-3, Ctla3, serine esterase 1, TSP1, Hf, BLT esterase, Hanukah factor
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14938
VEGA: 13
HGNC: HGNC:4708
Homologene: 21237
Or14c43
Name: olfactory receptor family 14 subfamily C member 43
Synonyms: Olfr299, GA_x6K02T2NHDJ-9643949-9642957, MOR221-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257929
Homologene: 115489
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
Bpifa2
Name: BPI fold containing family A, member 2
Synonyms: Psp, Bpifa2e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19194
Homologene: 69034
Pm20d1
Name: peptidase M20 domain containing 1
Synonyms: 4732466D17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212933
Homologene: 65049
Pnma2
Name: paraneoplastic antigen MA2
Synonyms: A830049P17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239157
HGNC: HGNC:9159
Homologene: 5249
Gm5150
Name: predicted gene 5150
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381484
Homologene: 129516
Amot
Name: angiomotin
Synonyms: D0Kist1, E230009N18Rik, Sii6
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 27494
Homologene: 15778
Eif1ad11
Name: eukaryotic translation initiation factor 1A domain containing 11
Synonyms: Gm2056
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039129
VEGA: 12
1700122O11Rik
Name: RIKEN cDNA 1700122O11 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76651
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 66,549,841 bp
  • A to T, chromosome 1 at 88,055,787 bp
  • G to T, chromosome 1 at 131,816,087 bp
  • T to G, chromosome 1 at 133,272,637 bp
  • A to G, chromosome 1 at 191,163,061 bp
  • C to T, chromosome 2 at 26,423,633 bp
  • A to G, chromosome 2 at 76,713,006 bp
  • T to C, chromosome 2 at 104,788,470 bp
  • C to A, chromosome 2 at 121,331,564 bp
  • A to G, chromosome 2 at 127,884,512 bp
  • G to T, chromosome 2 at 154,009,821 bp
  • C to A, chromosome 2 at 180,179,493 bp
  • A to G, chromosome 3 at 15,574,904 bp
  • G to T, chromosome 3 at 15,990,896 bp
  • A to T, chromosome 3 at 56,004,868 bp
  • G to A, chromosome 3 at 58,545,274 bp
  • A to G, chromosome 3 at 65,383,100 bp
  • G to T, chromosome 3 at 122,276,706 bp
  • G to T, chromosome 3 at 139,309,232 bp
  • C to G, chromosome 4 at 21,679,659 bp
  • A to T, chromosome 4 at 84,411,494 bp
  • T to A, chromosome 4 at 118,808,998 bp
  • A to G, chromosome 4 at 143,132,104 bp
  • A to T, chromosome 4 at 145,701,454 bp
  • T to A, chromosome 4 at 153,994,514 bp
  • GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC to GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC, chromosome 5 at 77,281,804 bp
  • A to T, chromosome 5 at 87,694,559 bp
  • A to G, chromosome 5 at 114,216,683 bp
  • T to A, chromosome 5 at 147,615,237 bp
  • G to A, chromosome 6 at 52,208,555 bp
  • A to G, chromosome 6 at 57,432,261 bp
  • A to T, chromosome 6 at 66,732,070 bp
  • A to G, chromosome 6 at 73,144,941 bp
  • T to A, chromosome 6 at 124,811,538 bp
  • T to A, chromosome 6 at 128,560,669 bp
  • C to A, chromosome 7 at 11,679,024 bp
  • A to G, chromosome 7 at 44,959,501 bp
  • T to A, chromosome 7 at 45,819,644 bp
  • G to A, chromosome 7 at 80,274,686 bp
  • A to T, chromosome 7 at 86,465,617 bp
  • A to G, chromosome 7 at 98,454,064 bp
  • T to A, chromosome 8 at 3,745,602 bp
  • A to G, chromosome 8 at 9,972,394 bp
  • T to C, chromosome 8 at 13,039,564 bp
  • A to T, chromosome 9 at 7,114,883 bp
  • G to A, chromosome 9 at 120,018,236 bp
  • G to T, chromosome 9 at 123,568,956 bp
  • C to A, chromosome 10 at 24,101,602 bp
  • A to G, chromosome 10 at 27,053,026 bp
  • A to G, chromosome 10 at 41,433,239 bp
  • G to A, chromosome 10 at 79,920,771 bp
  • T to A, chromosome 10 at 94,181,603 bp
  • T to C, chromosome 11 at 23,615,244 bp
  • T to C, chromosome 11 at 57,185,933 bp
  • T to C, chromosome 11 at 106,567,269 bp
  • A to C, chromosome 11 at 115,344,598 bp
  • T to A, chromosome 12 at 84,650,477 bp
  • T to A, chromosome 12 at 85,030,568 bp
  • A to G, chromosome 12 at 88,027,307 bp
  • A to G, chromosome 13 at 54,652,138 bp
  • A to T, chromosome 13 at 113,100,921 bp
  • C to A, chromosome 14 at 24,146,241 bp
  • A to G, chromosome 14 at 44,989,778 bp
  • A to C, chromosome 14 at 52,018,642 bp
  • A to G, chromosome 14 at 52,285,790 bp
  • A to G, chromosome 14 at 52,490,373 bp
  • A to T, chromosome 14 at 56,948,007 bp
  • G to A, chromosome 14 at 66,917,123 bp
  • T to G, chromosome 15 at 58,873,745 bp
  • T to A, chromosome 16 at 96,176,018 bp
  • T to C, chromosome 17 at 48,037,548 bp
  • C to T, chromosome 17 at 57,080,734 bp
  • C to A, chromosome 17 at 57,311,895 bp
  • A to G, chromosome 18 at 35,317,846 bp
  • G to T, chromosome 18 at 36,533,623 bp
  • A to G, chromosome 18 at 49,878,925 bp
  • A to T, chromosome 19 at 5,982,851 bp
  • A to T, chromosome 19 at 12,209,922 bp
  • C to G, chromosome 19 at 56,538,369 bp
  • A to T, chromosome X at 145,461,749 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9165 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068945-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.