Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9232Btlr/Mmmh
Stock Number:
068986-MU
Citation ID:
RRID:MMRRC_068986-MU
Other Names:
R9232 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133
Foxa3
Name: forkhead box A3
Synonyms: Tcf-3g, Hnf3g, Hnf-3g, Tcf3g
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15377
HGNC: HGNC:5023
Homologene: 3308
Lgals8
Name: lectin, galactose binding, soluble 8
Synonyms: Lgals-8, 1200015E08Rik, D13Ertd524e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56048
HGNC: HGNC:6569
Homologene: 31386
Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Cdc6
Name: cell division cycle 6
Synonyms: cell division cycle 18 homolog (S.pombe)-like, CDC18L, CDC18(S.pombe)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23834
HGNC: HGNC:1744
Homologene: 68172
Sik3
Name: SIK family kinase 3
Synonyms: 5730525O22Rik, 9030204A07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70661
Homologene: 57023
Xpo1
Name: exportin 1
Synonyms: Crm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103573
Homologene: 2554
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Atp5pd
Name: ATP synthase peripheral stalk subunit d
Synonyms: 0610009D10Rik, Atp5h
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71679
HGNC: HGNC:845
Homologene: 130552
Abhd3
Name: abhydrolase domain containing 3
Synonyms: LABH3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106861
Homologene: 14055
Erap1
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: PILSAP, ERAAP, Arts1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 80898
VEGA: 13
Homologene: 56754
Tap1
Name: transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms: RING4, PSF-1, MTP1, Tap-1, Ham-1, Ham1, Abcb2, TAP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21354
HGNC: HGNC:43
Homologene: 495
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Eif2a
Name: eukaryotic translation initiation factor 2A
Synonyms: D3Ertd194e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229317
HGNC: HGNC:3254
Homologene: 5969
Tmc2
Name: transmembrane channel-like gene family 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192140
Homologene: 25877
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Nlgn2
Name: neuroligin 2
Synonyms: NL2, NLG2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216856
Homologene: 69317
Iqch
Name: IQ motif containing H
Synonyms: 4921504K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78250
Homologene: 11258
Mob3b
Name: MOB kinase activator 3B
Synonyms: MOB3B, A430018A01Rik, 8430436F23Rik, Mobkl2b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214944
Homologene: 69385
Ceacam12
Name: CEA cell adhesion molecule 12
Synonyms: Ceacam12-C3, Ceacam12-C1, 1600031J20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67315
Homologene: 137375
Pramel25
Name: PRAME like 25
Synonyms: MGC:91194, Gm13023
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194227
Homologene: 103830
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: mGluR5, Gprc1e, 6430542K11Rik, Glu5R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Cenpt
Name: centromere protein T
Synonyms: G630055P03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320394
Homologene: 41610
Prss36
Name: serine protease 36
Synonyms: polyserase-2, C330007D15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77613
Homologene: 18303
Trim28
Name: tripartite motif-containing 28
Synonyms: KRIP-1, KAP-1, Tif1b, MommeD9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21849
Homologene: 21175
Tgfbr3
Name: transforming growth factor, beta receptor III
Synonyms: betaglycan, TBRIII, 1110036H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21814
Homologene: 2436
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269152
Homologene: 18623
Tph1
Name: tryptophan hydroxylase 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21990
Homologene: 121565
Vmn1r39
Name: vomeronasal 1 receptor 39
Synonyms: Gm5993
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546903
Homologene: 110800
Gtf3c4
Name: general transcription factor IIIC, polypeptide 4
Synonyms: KAT12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269252
HGNC: HGNC:4667
Homologene: 8147
Adgrf1
Name: adhesion G protein-coupled receptor F1
Synonyms: 5031409J19Rik, Gpr110
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77596
Homologene: 124643
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Slc22a20
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: LOC381203, mOAT6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381203
Homologene: 87203
Cnnm1
Name: cyclin M1
Synonyms: Acdp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83674
VEGA: 19
HGNC: HGNC:102
Homologene: 10673
Lztr1
Name: leucine-zipper-like transcriptional regulator, 1
Synonyms: TCFL2, 1200003E21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66863
HGNC: HGNC:6742
Homologene: 4925
Rabggta
Name: Rab geranylgeranyl transferase, a subunit
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56187
VEGA: 14
HGNC: HGNC:9795
Homologene: 32443
Foxf1
Name: forkhead box F1
Synonyms: FREAC1, Hfh8, Freac-1, HFH-8, Foxf1, Foxf1a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15227
HGNC: HGNC:3809
Homologene: 1114
Proser2
Name: proline and serine rich 2
Synonyms: 5430407P10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227545
Homologene: 51648
Cntn6
Name: contactin 6
Synonyms: NB-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53870
HGNC: HGNC:2176
Homologene: 8702
Gbp11
Name: guanylate binding protein 11
Synonyms: Gm7141
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 634650
Homologene: 128731
Defb43
Name: defensin beta 43
Synonyms: EG654458
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 654458
Homologene: 86860
Trim56
Name: tripartite motif-containing 56
Synonyms: LOC384309, RNF109, A130009K11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384309
Homologene: 12812
Sepsecs
Name: Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
Synonyms: SLA, D5Ertd135e, SecS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211006
Homologene: 15031
Gm10271
Name: predicted gene 10271
Type: Gene
Species: Mouse
Chromosome: 10
Hps4
Name: HPS4, biogenesis of lysosomal organelles complex 3 subunit 2
Synonyms: C130020P05Rik, BLOC-3, 2010205O06Rik, Hermansky-Pudlak syndrome 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192232
Homologene: 11123
Trib3
Name: tribbles pseudokinase 3
Synonyms: Trb3, Nipk, SKIP3, Ifld2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228775
Homologene: 10902
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 63,308,009 bp
  • T to A, chromosome 1 at 118,836,291 bp
  • T to C, chromosome 1 at 140,484,193 bp
  • G to A, chromosome 1 at 178,914,946 bp
  • A to G, chromosome 2 at 6,101,204 bp
  • A to G, chromosome 2 at 28,834,836 bp
  • A to G, chromosome 2 at 130,243,129 bp
  • A to T, chromosome 2 at 152,343,042 bp
  • T to C, chromosome 3 at 58,555,601 bp
  • G to A, chromosome 3 at 59,336,422 bp
  • T to C, chromosome 3 at 94,622,138 bp
  • T to C, chromosome 4 at 34,986,101 bp
  • A to G, chromosome 4 at 43,240,321 bp
  • T to G, chromosome 4 at 143,793,693 bp
  • A to G, chromosome 5 at 52,666,002 bp
  • A to G, chromosome 5 at 75,639,132 bp
  • T to C, chromosome 5 at 105,328,424 bp
  • T to C, chromosome 5 at 107,142,495 bp
  • G to A, chromosome 5 at 112,378,039 bp
  • A to G, chromosome 5 at 137,112,778 bp
  • T to A, chromosome 5 at 140,105,541 bp
  • A to G, chromosome 6 at 66,804,596 bp
  • T to C, chromosome 6 at 104,838,820 bp
  • G to A, chromosome 7 at 13,029,563 bp
  • T to A, chromosome 7 at 18,069,416 bp
  • C to A, chromosome 7 at 19,014,865 bp
  • A to G, chromosome 7 at 46,662,105 bp
  • G to A, chromosome 7 at 88,074,383 bp
  • T to C, chromosome 7 at 127,944,816 bp
  • T to C, chromosome 8 at 105,845,161 bp
  • T to A, chromosome 8 at 121,084,976 bp
  • T to C, chromosome 9 at 18,656,040 bp
  • C to T, chromosome 9 at 46,211,918 bp
  • T to A, chromosome 9 at 63,421,918 bp
  • T to A, chromosome 10 at 116,972,574 bp
  • T to C, chromosome 11 at 23,282,646 bp
  • T to C, chromosome 11 at 69,828,029 bp
  • T to G, chromosome 11 at 98,910,375 bp
  • A to G, chromosome 11 at 115,418,395 bp
  • A to G, chromosome 12 at 57,729,424 bp
  • C to T, chromosome 13 at 12,454,896 bp
  • T to G, chromosome 13 at 74,663,518 bp
  • C to T, chromosome 14 at 55,719,288 bp
  • A to G, chromosome 14 at 63,017,832 bp
  • A to G, chromosome 15 at 66,698,461 bp
  • T to C, chromosome 16 at 17,521,479 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • T to C, chromosome 17 at 34,193,303 bp
  • T to C, chromosome 17 at 43,310,404 bp
  • A to T, chromosome 18 at 10,652,198 bp
  • A to T, chromosome 19 at 5,972,981 bp
  • A to G, chromosome 19 at 38,716,979 bp
  • T to A, chromosome 19 at 43,491,886 bp
  • T to C, chromosome X at 101,308,784 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9232 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068986-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.