Strain Name:
C57BL/6J-MtgxR9381Btlr/Mmmh
Stock Number:
068992-MU
Citation ID:
RRID:MMRRC_068992-MU
Other Names:
R9381 (G1)
Major Collection:

Strain Information

Acadl
Name: acyl-Coenzyme A dehydrogenase, long-chain
Synonyms: LCAD, C79855
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11363
HGNC: HGNC:88
Homologene: 37498
Nae1
Name: NEDD8 activating enzyme E1 subunit 1
Synonyms: Appbp1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234664
HGNC: HGNC:621
Homologene: 68370
Npy2r
Name: neuropeptide Y receptor Y2
Synonyms: NPY-Y2 receptor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18167
HGNC: HGNC:7957
Homologene: 701
Emb
Name: embigin
Synonyms: Gp70
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13723
Homologene: 7743
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Rabggtb
Name: Rab geranylgeranyl transferase, b subunit
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19352
HGNC: HGNC:9796
Homologene: 3371
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: 4933425K22Rik, Gtar, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Aff1
Name: AF4/FMR2 family, member 1
Synonyms: Af4, Rob, 9630032B01Rik, Mllt2h
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17355
HGNC: HGNC:7135
Homologene: 4340
Exoc5
Name: exocyst complex component 5
Synonyms: PRO1912, SEC10, Sec10l1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105504
Homologene: 38195
Larp1
Name: La ribonucleoprotein 1, translational regulator
Synonyms: Larp, 1810024J12Rik, 3110040D16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73158
Homologene: 9089
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, par, Emv66
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Wipf2
Name: WAS/WASL interacting protein family, member 2
Synonyms: 1110014J05Rik, 5730509C05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68524
Homologene: 15777
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Ube2d3
Name: ubiquitin-conjugating enzyme E2D 3
Synonyms: 9430029A22Rik, 1100001F19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66105
Homologene: 123914
Rbm15
Name: RNA binding motif protein 15
Synonyms: C230088J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229700
Homologene: 23383
Jup
Name: junction plakoglobin
Synonyms: PG, plakoglobin, gamma-catenin, D930025P04Rik, Ctnng
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Strip2
Name: striatin interacting protein 2
Synonyms: Myoscape, D330017J20Rik, Fam40b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320609
Homologene: 66198
Sptb
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, D330027P03Rik, LOC383567, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20741
Homologene: 295
Il20rb
Name: interleukin 20 receptor beta
Synonyms: LOC213208, Fndc6, Il20R2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 213208
HGNC: HGNC:6004
Homologene: 86034
Il31ra
Name: interleukin 31 receptor A
Synonyms: GLM-R, GPL
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218624
VEGA: 13
Homologene: 51395
Mpzl1
Name: myelin protein zero-like 1
Synonyms: 1110007A10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68481
HGNC: HGNC:7226
Homologene: 2939
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
Snrnp48
Name: small nuclear ribonucleoprotein 48 (U11/U12)
Synonyms: 1110050F08Rik, 6530403A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67797
VEGA: 13
Homologene: 12191
Ddhd2
Name: DDHD domain containing 2
Synonyms: SAMWD1, 2010305K11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72108
Homologene: 66646
Raph1
Name: Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms: C730009O10Rik, 9430025M21Rik, lamellipodin, Lpd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77300
Homologene: 71030
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225115
Homologene: 25090
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: Trrp7, LTRPC2, TRPC7, 9830168K16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Nr2e1
Name: nuclear receptor subfamily 2, group E, member 1
Synonyms: Nr2e1, Mtll, Tlx, tailless
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21907
HGNC: HGNC:7973
Homologene: 37750
Bhlhe40
Name: basic helix-loop-helix family, member e40
Synonyms: eip1 (E47 interaction protein 1), Stra13, CR8, cytokine response gene 8, Clast5, C130042M06Rik, Stra14, DEC1, Sharp2, Bhlhb2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20893
HGNC: HGNC:1046
Homologene: 2722
Elfn1
Name: leucine rich repeat and fibronectin type III, extracellular 1
Synonyms: A930017N06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243312
Homologene: 18465
Kat2a
Name: K(lysine) acetyltransferase 2A
Synonyms: PCAF-B/GCN5, 1110051E14Rik, Gcn5, Gcn5l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14534
HGNC: HGNC:4201
Homologene: 41343
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Zfyve28
Name: zinc finger, FYVE domain containing 28
Synonyms: 9630058O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231125
Homologene: 15119
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: DMPK-like, A930014J19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Slc22a29
Name: solute carrier family 22. member 29
Synonyms: D630002G06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236293
Homologene: 77136
C5ar2
Name: complement component 5a receptor 2
Synonyms: C5L2, E030029A11Rik, Gpr77
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319430
HGNC: HGNC:4527
Homologene: 49549
Samd3
Name: sterile alpha motif domain containing 3
Synonyms: LOC268288
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268288
VEGA: 10
Homologene: 67991
Lrrd1
Name: leucine rich repeats and death domain containing 1
Synonyms: 4932412H11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242838
Homologene: 18247
Dalrd3
Name: DALR anticodon binding domain containing 3
Synonyms: 6330580J24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67789
Homologene: 32388
Atg9a
Name: autophagy related 9A
Synonyms: Apg9l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 245860
Homologene: 34495
Tbc1d2b
Name: TBC1 domain family, member 2B
Synonyms: 1810061M12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67016
Homologene: 56694
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Ppp3cc
Name: protein phosphatase 3, catalytic subunit, gamma isoform
Synonyms: PP2BA gamma, Calnc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19057
VEGA: 14
HGNC: HGNC:9316
Homologene: 68475
Adamts15
Name: ADAM metallopeptidase with thrombospondin type 1 motif 15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235130
VEGA: 9
Homologene: 8610
Or5b124
Name: olfactory receptor family 5 subfamily B member 124
Synonyms: GA_x6K02T2RE5P-3965668-3966609, MOR202-19, Olfr1489
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258628
Homologene: 45021
Ces3b
Name: carboxylesterase 3B
Synonyms: ES31L, Gm4738
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13909
HGNC: HGNC:1865
Homologene: 84407
Mrps31
Name: mitochondrial ribosomal protein S31
Synonyms: Imogen44, 1500002D03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 57312
Homologene: 4255
Tmtc4
Name: transmembrane and tetratricopeptide repeat containing 4
Synonyms: 5730419O14Rik, 4930403J22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70551
Homologene: 32796
Or5p50
Name: olfactory receptor family 5 subfamily P member 50
Synonyms: GA_x6K02T2PBJ9-10152980-10152036, MOR204-21, Olfr469
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258418
Homologene: 44979
Pabpc1l
Name: poly(A) binding protein, cytoplasmic 1-like
Synonyms: ePAB, 1810053B01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381404
Homologene: 77989
Prpsap2
Name: phosphoribosyl pyrophosphate synthetase-associated protein 2
Synonyms: A230054F23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 212627
HGNC: HGNC:9467
Homologene: 2073
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
H2-Q1
Name: histocompatibility 2, Q region locus 1
Synonyms: H-2Q1, Q1, Q1k, Q1d, Q1b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15006
Homologene: 128352
Vdr
Name: vitamin D (1,25-dihydroxyvitamin D3) receptor
Synonyms: Nr1i1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22337
Homologene: 37297
Ceacam3
Name: CEA cell adhesion molecule 3
Synonyms: cea12, EG384557, Psg24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384557
HGNC: HGNC:1819
Homologene: 86971
Dok1
Name: docking protein 1
Synonyms: p62DOK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13448
HGNC: HGNC:2990
Homologene: 1057
Bco1
Name: beta-carotene oxygenase 1
Synonyms: beta-CD, Bcdo, Bcdo1, betaCMOOX, Cmoi, Bcmo1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 63857
Homologene: 41172
Togaram1
Name: TOG array regulator of axonemal microtubules 1
Synonyms: A430041B07Rik, Fam179b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328108
VEGA: 12
Homologene: 15025
9930111J21Rik1
Name: RIKEN cDNA 9930111J21 gene 1
Synonyms: 9930111J21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 667214
Homologene: 83188
Asb3
Name: ankyrin repeat and SOCS box-containing 3
Synonyms: 2400011J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 65257
Homologene: 9391
Pafah1b3
Name: platelet-activating factor acetylhydrolase, isoform 1b, subunit 3
Synonyms: mus[g], Pafahg, PAF-AH alpha1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18476
HGNC: HGNC:8576
Homologene: 1933
Slco1a7
Name: solute carrier organic anion transporter family, member 1a7
Synonyms: Gm5724
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 435927
Aig1
Name: androgen-induced 1
Synonyms: CGI-103, 1500031O19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66253
Homologene: 32297
Hs3st3b1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Synonyms: 3OST3B1, HS3ST3B1, 3-OST-3B, m3-OST-3B, 3Ost3b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54710
HGNC: HGNC:5198
Homologene: 88576
Zfp128
Name: zinc finger protein 128
Synonyms: mZnf8, 9630016P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243833
Homologene: 10889
Or51d1
Name: olfactory receptor family 51 subfamily D member 1
Synonyms: GA_x6K02T2PBJ9-5414934-5415902, MOR18-3, Olfr557
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258358
Homologene: 123803
Tmem102
Name: transmembrane protein 102
Synonyms: Tmem102-ps, Cbap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380705
Homologene: 86820
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Abhd16b
Name: abhydrolase domain containing 16B
Synonyms: BC050777
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241850
Homologene: 15422
Rasd2
Name: RASD family, member 2
Synonyms: TEM2, TEM-2, Rhes, 4930526B11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75141
Homologene: 8628
Pcdhga6
Name: protocadherin gamma subfamily A, 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93714
HGNC: HGNC:8704
Homologene: 129611
Gm28363
Name: predicted gene 28363
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 60,501,800 bp
  • T to C, chromosome 1 at 66,854,646 bp
  • T to A, chromosome 1 at 75,186,082 bp
  • T to A, chromosome 1 at 117,726,885 bp
  • T to C, chromosome 1 at 165,601,754 bp
  • T to C, chromosome 1 at 180,141,483 bp
  • G to T, chromosome 2 at 164,025,503 bp
  • A to G, chromosome 2 at 181,109,769 bp
  • A to G, chromosome 2 at 181,494,088 bp
  • T to C, chromosome 3 at 82,541,049 bp
  • C to T, chromosome 3 at 90,199,866 bp
  • T to C, chromosome 3 at 107,331,436 bp
  • A to T, chromosome 3 at 135,462,961 bp
  • A to T, chromosome 3 at 153,908,180 bp
  • T to C, chromosome 4 at 91,308,772 bp
  • A to G, chromosome 5 at 3,851,074 bp
  • A to G, chromosome 5 at 22,344,204 bp
  • G to A, chromosome 5 at 34,216,588 bp
  • T to C, chromosome 5 at 73,083,294 bp
  • C to T, chromosome 5 at 90,268,649 bp
  • A to T, chromosome 5 at 103,833,867 bp
  • T to C, chromosome 5 at 113,819,856 bp
  • A to T, chromosome 5 at 121,334,429 bp
  • T to C, chromosome 5 at 139,973,707 bp
  • T to C, chromosome 6 at 3,592,433 bp
  • T to C, chromosome 6 at 29,927,334 bp
  • T to C, chromosome 6 at 83,032,991 bp
  • T to C, chromosome 6 at 108,665,283 bp
  • T to C, chromosome 6 at 141,765,764 bp
  • T to C, chromosome 7 at 12,890,970 bp
  • A to T, chromosome 7 at 16,236,962 bp
  • C to G, chromosome 7 at 17,159,790 bp
  • A to C, chromosome 7 at 25,295,274 bp
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp
  • A to T, chromosome 7 at 102,698,447 bp
  • A to C, chromosome 7 at 107,822,605 bp
  • G to A, chromosome 8 at 22,414,736 bp
  • G to T, chromosome 8 at 25,749,822 bp
  • T to C, chromosome 8 at 75,221,961 bp
  • A to T, chromosome 8 at 104,523,607 bp
  • T to C, chromosome 8 at 105,085,038 bp
  • T to A, chromosome 8 at 117,110,892 bp
  • A to G, chromosome 9 at 30,902,520 bp
  • T to C, chromosome 9 at 89,087,589 bp
  • A to G, chromosome 9 at 90,219,086 bp
  • A to G, chromosome 9 at 100,461,488 bp
  • A to G, chromosome 9 at 108,571,043 bp
  • C to A, chromosome 9 at 110,378,771 bp
  • T to C, chromosome 10 at 13,647,673 bp
  • T to A, chromosome 10 at 26,271,745 bp
  • T to A, chromosome 10 at 27,188,027 bp
  • T to A, chromosome 10 at 42,563,472 bp
  • T to A, chromosome 10 at 77,911,357 bp
  • A to T, chromosome 10 at 127,605,468 bp
  • T to C, chromosome 11 at 31,101,088 bp
  • T to A, chromosome 11 at 48,948,377 bp
  • A to G, chromosome 11 at 58,058,706 bp
  • C to T, chromosome 11 at 58,859,181 bp
  • T to C, chromosome 11 at 61,744,956 bp
  • C to T, chromosome 11 at 63,921,866 bp
  • T to C, chromosome 11 at 69,804,315 bp
  • A to G, chromosome 11 at 98,896,242 bp
  • C to T, chromosome 11 at 100,379,565 bp
  • T to C, chromosome 11 at 100,711,866 bp
  • A to G, chromosome 11 at 109,139,558 bp
  • T to A, chromosome 11 at 118,023,393 bp
  • T to C, chromosome 12 at 64,967,430 bp
  • T to C, chromosome 12 at 66,550,530 bp
  • C to T, chromosome 12 at 76,587,518 bp
  • T to C, chromosome 12 at 114,665,978 bp
  • A to C, chromosome 13 at 38,220,691 bp
  • A to G, chromosome 13 at 73,800,944 bp
  • C to A, chromosome 13 at 97,899,761 bp
  • A to T, chromosome 13 at 112,531,719 bp
  • G to T, chromosome 13 at 117,220,560 bp
  • C to T, chromosome 14 at 49,037,737 bp
  • T to A, chromosome 14 at 70,224,992 bp
  • T to G, chromosome 14 at 122,926,029 bp
  • G to A, chromosome 15 at 97,857,452 bp
  • A to T, chromosome 17 at 28,054,005 bp
  • A to G, chromosome 17 at 35,323,162 bp
  • T to C, chromosome 17 at 67,737,484 bp
  • A to T, chromosome 17 at 75,389,439 bp
  • A to T, chromosome 18 at 5,099,013 bp
  • A to T, chromosome 18 at 37,708,318 bp
  • T to G, chromosome 18 at 67,442,381 bp
  • A to G, chromosome 19 at 8,218,477 bp
  • G to T, chromosome 19 at 13,633,283 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9381 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068992-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.