Strain Name:
C57BL/6J-MtgxR9093Btlr/Mmmh
Stock Number:
068997-MU
Citation ID:
RRID:MMRRC_068997-MU
Other Names:
R9093 (G1)
Major Collection:

Strain Information

Tnfsf4
Name: tumor necrosis factor (ligand) superfamily, member 4
Synonyms: TXGP1, gp34, Txgp1l, Ath1, CD134L, Ath-1, OX40L
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22164
Homologene: 2495
Lrig3
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9430095K15Rik, 9030421L11Rik, 9130004I02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Slk
Name: STE20-like kinase
Synonyms: mSLK, Etk4, SLK, Stk2, 9A2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Rnmt
Name: RNA (guanine-7-) methyltransferase
Synonyms: 2610002P10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67897
Homologene: 2816
Fbxo31
Name: F-box protein 31
Synonyms: Fbx14, 1110003O08Rik, 2310046N15Rik, Fbxo14
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Rbfox2
Name: RNA binding protein, fox-1 homolog (C. elegans) 2
Synonyms: 2810460A15Rik, Rbm9, Fbm2, Fxh
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 93686
VEGA: 15
HGNC: HGNC:9906
Homologene: 49375
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Chd4
Name: chromodomain helicase DNA binding protein 4
Synonyms: D6Ertd380e, Mi-2beta, 9530019N15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107932
HGNC: HGNC:1919
Homologene: 68175
Nasp
Name: nuclear autoantigenic sperm protein (histone-binding)
Synonyms: D4Ertd767e, Epcs32, 5033430J04Rik, Nasp-T
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50927
HGNC: HGNC:7644
Homologene: 133894
Hif1a
Name: hypoxia inducible factor 1, alpha subunit
Synonyms: HIF1alpha, bHLHe78, MOP1, HIF-1alpha
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15251
HGNC: HGNC:4910
Homologene: 1171
Tonsl
Name: tonsoku-like, DNA repair protein
Synonyms: Nfkbil2, 2810439M11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72749
HGNC: HGNC:7801
Homologene: 22754
Gas2
Name: growth arrest specific 2
Synonyms: Gas-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14453
HGNC: HGNC:4167
Homologene: 31301
Tmem135
Name: transmembrane protein 135
Synonyms: 2810439K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72759
Homologene: 11295
Clca2
Name: chloride channel accessory 2
Synonyms: Clca5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229933
HGNC: HGNC:2016
Homologene: 4765
Fhip1b
Name: FHF complex subunit HOOK interacting protein 1B
Synonyms: 6530415H11Rik, 4632419K20Rik, Fam160a2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74349
Homologene: 75329
Enpp3
Name: ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms: CD203c
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209558
VEGA: 10
HGNC: HGNC:3358
Homologene: 3683
Wbp11
Name: WW domain binding protein 11
Synonyms: Npwbp, D6Wsu113e, SIPP1, 2510026P17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60321
Homologene: 134037
Chst15
Name: carbohydrate sulfotransferase 15
Synonyms: GalNAcS-6ST, MAd5, MAd5, 4631426J05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77590
Homologene: 8908
Cenpe
Name: centromere protein E
Synonyms: CENP-E, Kif10, 312kDa, N-7 kinesin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Nid2
Name: nidogen 2
Synonyms: entactin 2, entactin-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18074
VEGA: 14
Homologene: 40575
Cul1
Name: cullin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26965
HGNC: HGNC:2551
Homologene: 2663
Kif24
Name: kinesin family member 24
Synonyms: 4933425J19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109242
Homologene: 52346
Zfp386
Name: zinc finger protein 386 (Kruppel-like)
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56220
Homologene: 51668
Tmem64
Name: transmembrane protein 64
Synonyms: 9630015D15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100201
Homologene: 45636
Eno4
Name: enolase 4
Synonyms: 6430537H07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226265
Homologene: 18691
Rnf214
Name: ring finger protein 214
Synonyms: D130054N24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235315
Homologene: 109357
Klhl20
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226541
Homologene: 8699
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Scn4a
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: SkM1, mH2, Nav1.4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110880
Homologene: 283
Nutm2
Name: NUT family member 2
Synonyms: Gm806, LOC328250
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328250
Homologene: 128615
Rasef
Name: RAS and EF hand domain containing
Synonyms: RAB45
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242505
Homologene: 28424
Aff3
Name: AF4/FMR2 family, member 3
Synonyms: LAF-4, Laf4, 3222402O04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16764
HGNC: HGNC:6473
Homologene: 1718
Glp2r
Name: glucagon-like peptide 2 receptor
Synonyms: 9530092J08Rik, GLP-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93896
HGNC: HGNC:4325
Homologene: 3132
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Rab11fip1
Name: RAB11 family interacting protein 1 (class I)
Synonyms: 4833414G05Rik, 2010200K21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75767
Homologene: 11853
Ada
Name: adenosine deaminase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11486
HGNC: HGNC:186
Homologene: 37249
Ankrd48
Name: ankyrin repeat domain 48
Synonyms: GC3, 1700012M14Rik, Ankrd36, 1700008J08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76389
Homologene: 137366
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: E330009N23Rik, Fbx12, Fbxo12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50757
Homologene: 110776
E230025N22Rik
Name: Riken cDNA E230025N22 gene
Synonyms: EG240216
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240216
Homologene: 131194
Nup210
Name: nucleoporin 210
Synonyms: gp190, Pom210, gp210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Gjb3
Name: gap junction protein, beta 3
Synonyms: D4Wsu144e, connexin 31, Cx31, Cnx31, Gjb-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14620
HGNC: HGNC:4285
Homologene: 7338
Loxl1
Name: lysyl oxidase-like 1
Synonyms: LOXL
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16949
VEGA: 9
HGNC: HGNC:6665
Homologene: 4074
Sdcbp
Name: syndecan binding protein
Synonyms: Sycl, syntenin, syntenin-1, syndecan interacting protein, MDA-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53378
Homologene: 4110
Ube4a
Name: ubiquitination factor E4A
Synonyms: UFD2b, 9930123J21Rik, 4732444G18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 140630
Homologene: 3517
Or7g33
Name: olfactory receptor family 7 subfamily G member 33
Synonyms: MOR154-1, Olfr853, GA_x6K02T2PVTD-13277703-13276786
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258908
HGNC: HGNC:8466
Homologene: 133623
Rnf19a
Name: ring finger protein 19A
Synonyms: XY body protein, Rnf19, XYbp, Dorfin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 30945
VEGA: 15
Homologene: 8501
Or56b1b
Name: olfactory receptor family 56 subfamily B member 1B
Synonyms: GA_x6K02T2PBJ9-10895499-10894543, MOR40-15, MOR40-7P, Olfr504
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258163
Homologene: 17189
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: Catsperg, A230107C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320225
Homologene: 10915
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625131
Homologene: 129606
Tent5b
Name: terminal nucleotidyltransferase 5B
Synonyms: Fam46b, 4732473B16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100342
Homologene: 24928
Or2a20
Name: olfactory receptor family 2 subfamily A member 2
Synonyms: GA_x6K02T2P3E9-4341246-4340281, Olfr434, MOR261-10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258366
Homologene: 133700
H2bc18
Name: H2B clustered histone 18
Synonyms: H2b-616, Hist2h2bb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319189
Homologene: 136264
Cfap221
Name: cilia and flagella associated protein 221
Synonyms: Pcdp1, Gm101
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226356
Homologene: 88578
Calhm2
Name: calcium homeostasis modulator family member 2
Synonyms: 2810048G17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72691
Homologene: 9303
Fbh1
Name: F-box DNA helicase 1
Synonyms: Fbx18, Fbxo18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50755
Homologene: 9272
Aldh3b3
Name: aldehyde dehydrogenase 3 family, member B3
Synonyms: 1700055N04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73458
HGNC: HGNC:411
Homologene: 133295
Maip1
Name: matrix AAA peptidase interacting protein 1
Synonyms: 9430016H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68115
Homologene: 11565
Or9m1
Name: olfactory receptor family 9 subfamily M member 1
Synonyms: MOR173-2, GA_x6K02T2Q125-49403456-49402524, Olfr1154
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258641
Homologene: 74192
Slfn3
Name: schlafen 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20557
Homologene: 133236
Ndufb8
Name: NADH:ubiquinone oxidoreductase subunit B8
Synonyms: 2900010I05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67264
HGNC: HGNC:7703
Homologene: 3668
Or5ak20
Name: olfactory receptor family 5 subfamily AK member 20
Synonyms: MOR203-5P, Olfr988, GA_x6K02T2Q125-46830591-46829662
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258166
Homologene: 103791
Gm17430
Name: predicted gene, 17430
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 118568368
VEGA: 18
Art5
Name: ADP-ribosyltransferase 5
Synonyms: Yac-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11875
Homologene: 7231
Odad1
Name: outer dynein arm docking complex subunit 1
Synonyms: Ccdc114
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211535
Homologene: 128610
Or8b9
Name: olfactory receptor family 8 subfamily B member 9
Synonyms: Olfr877, GA_x6K02T2PVTD-31540342-31541277, MOR161-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258412
Homologene: 121556
Or10a3n
Name: olfactory receptor family 10 subfamily A member 3N
Synonyms: Olfr519, MOR268-6, GA_x6K02T2PBJ9-11224559-11223615
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277935
Homologene: 17186
Hoxd11
Name: homeobox D11
Synonyms: Hox-5.5, E230017H14Rik, Hox-5.4, Hox-4.6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15431
HGNC: HGNC:5134
Homologene: 7368
Mrm2
Name: mitochondrial rRNA methyltransferase 2
Synonyms: Ftsj2, 2310037B18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68017
Homologene: 5907
Pou2af2
Name: POU domain, class 2, associating factor 2
Synonyms: Oca-t1, 1810046K07Rik, OCA-B homolog
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69809
Homologene: 18881
Gyg1
Name: glycogenin 1
Synonyms: Gyg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27357
HGNC: HGNC:4699
Homologene: 31219
Pm20d1
Name: peptidase M20 domain containing 1
Synonyms: 4732466D17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212933
Homologene: 65049
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, Cklfsf1, CKLFH1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Pcdhga12
Name: protocadherin gamma subfamily A, 12
Synonyms: pc2c, Pcdh13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93724
HGNC: HGNC:8699
Homologene: 134588
Vmn2r40
Name: vomeronasal 2, receptor 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042781
Homologene: 113703
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 38,252,657 bp (GRCm38)
  • A to T, chromosome 1 at 57,407,152 bp (GRCm38)
  • G to T, chromosome 1 at 119,936,126 bp (GRCm38)
  • G to T, chromosome 1 at 131,816,015 bp (GRCm38)
  • A to T, chromosome 1 at 161,095,661 bp (GRCm38)
  • T to C, chromosome 1 at 161,417,058 bp (GRCm38)
  • T to A, chromosome 2 at 11,759,990 bp (GRCm38)
  • A to T, chromosome 2 at 69,239,169 bp (GRCm38)
  • A to T, chromosome 2 at 74,684,138 bp (GRCm38)
  • T to A, chromosome 2 at 85,353,508 bp (GRCm38)
  • A to T, chromosome 2 at 87,903,136 bp (GRCm38)
  • C to T, chromosome 2 at 163,735,388 bp (GRCm38)
  • T to A, chromosome 3 at 20,122,737 bp (GRCm38)
  • G to A, chromosome 3 at 96,269,974 bp (GRCm38)
  • C to T, chromosome 3 at 135,239,880 bp (GRCm38)
  • T to C, chromosome 3 at 145,075,720 bp (GRCm38)
  • G to T, chromosome 4 at 6,386,709 bp (GRCm38)
  • A to G, chromosome 4 at 15,266,391 bp (GRCm38)
  • A to G, chromosome 4 at 41,428,691 bp (GRCm38)
  • T to C, chromosome 4 at 73,780,346 bp (GRCm38)
  • G to T, chromosome 4 at 116,610,820 bp (GRCm38)
  • GCCAGATGCGCCCA to GCCAGATGCGCCCAGATGCGCCCA, chromosome 4 at 127,326,665 bp (GRCm38)
  • A to G, chromosome 4 at 133,487,041 bp (GRCm38)
  • A to G, chromosome 5 at 121,273,614 bp (GRCm38)
  • A to T, chromosome 5 at 140,328,672 bp (GRCm38)
  • A to G, chromosome 6 at 43,217,566 bp (GRCm38)
  • T to A, chromosome 6 at 47,518,239 bp (GRCm38)
  • T to A, chromosome 6 at 91,089,890 bp (GRCm38)
  • A to G, chromosome 6 at 125,114,011 bp (GRCm38)
  • A to T, chromosome 6 at 136,826,046 bp (GRCm38)
  • A to G, chromosome 7 at 8,908,173 bp (GRCm38)
  • G to C, chromosome 7 at 29,184,727 bp (GRCm38)
  • G to A, chromosome 7 at 45,947,541 bp (GRCm38)
  • T to A, chromosome 7 at 51,953,221 bp (GRCm38)
  • T to A, chromosome 7 at 89,147,996 bp (GRCm38)
  • G to T, chromosome 7 at 102,098,189 bp (GRCm38)
  • T to A, chromosome 7 at 105,385,392 bp (GRCm38)
  • A to T, chromosome 7 at 108,565,247 bp (GRCm38)
  • T to C, chromosome 7 at 108,894,402 bp (GRCm38)
  • A to T, chromosome 7 at 132,268,917 bp (GRCm38)
  • A to G, chromosome 8 at 27,143,327 bp (GRCm38)
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp (GRCm38)
  • G to A, chromosome 8 at 121,554,397 bp (GRCm38)
  • A to G, chromosome 9 at 19,537,618 bp (GRCm38)
  • A to T, chromosome 9 at 37,854,998 bp (GRCm38)
  • A to T, chromosome 9 at 44,953,164 bp (GRCm38)
  • A to G, chromosome 9 at 45,899,756 bp (GRCm38)
  • G to A, chromosome 9 at 51,290,216 bp (GRCm38)
  • C to A, chromosome 9 at 58,311,941 bp (GRCm38)
  • A to G, chromosome 9 at 109,276,182 bp (GRCm38)
  • G to A, chromosome 10 at 24,795,804 bp (GRCm38)
  • T to A, chromosome 10 at 92,815,908 bp (GRCm38)
  • C to T, chromosome 10 at 126,010,081 bp (GRCm38)
  • G to A, chromosome 10 at 130,472,296 bp (GRCm38)
  • G to A, chromosome 11 at 5,639,132 bp (GRCm38)
  • C to T, chromosome 11 at 54,597,086 bp (GRCm38)
  • T to A, chromosome 11 at 67,730,633 bp (GRCm38)
  • A to G, chromosome 11 at 83,213,122 bp (GRCm38)
  • T to A, chromosome 11 at 83,324,569 bp (GRCm38)
  • G to A, chromosome 11 at 106,319,812 bp (GRCm38)
  • T to C, chromosome 12 at 73,932,337 bp (GRCm38)
  • C to A, chromosome 12 at 116,060,258 bp (GRCm38)
  • A to G, chromosome 12 at 119,446,826 bp (GRCm38)
  • A to G, chromosome 13 at 50,474,928 bp (GRCm38)
  • C to T, chromosome 14 at 19,807,941 bp (GRCm38)
  • A to T, chromosome 15 at 23,473,978 bp (GRCm38)
  • A to C, chromosome 15 at 36,253,304 bp (GRCm38)
  • A to T, chromosome 15 at 76,631,070 bp (GRCm38)
  • G to A, chromosome 15 at 76,705,485 bp (GRCm38)
  • A to T, chromosome 15 at 77,306,458 bp (GRCm38)
  • A to G, chromosome 18 at 9,726,640 bp (GRCm38)
  • G to T, chromosome 18 at 36,688,899 bp (GRCm38)
  • C to A, chromosome 18 at 37,766,878 bp (GRCm38)
  • A to C, chromosome 18 at 68,318,075 bp (GRCm38)
  • T to A, chromosome 19 at 3,963,959 bp (GRCm38)
  • A to T, chromosome 19 at 44,550,384 bp (GRCm38)
  • A to C, chromosome 19 at 47,133,160 bp (GRCm38)
  • A to G, chromosome 19 at 47,615,444 bp (GRCm38)
  • A to T, chromosome 19 at 58,953,168 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9093 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068997-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.