Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9099Btlr/Mmmh
Stock Number:
068998-MU
Citation ID:
RRID:MMRRC_068998-MU
Other Names:
R9099 (G1)
Major Collection:

Strain Information

Exoc6b
Name: exocyst complex component 6B
Synonyms: 4930569O18Rik, G430127E12Rik, Sec15b, Sec15l2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75914
Homologene: 44781
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Fam222b
Name: family with sequence similarity 222, member B
Synonyms: BC017647
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216971
Homologene: 10054
Zfp292
Name: zinc finger protein 292
Synonyms: Zn-16, Zn-15, Krox-10, Zfp-15, 9430062L07Rik, 5730450D02Rik, Zfp15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30046
Homologene: 8493
Nfs1
Name: nitrogen fixation gene 1 (S. cerevisiae)
Synonyms: m-Nfs1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18041
Homologene: 5463
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Ei24
Name: etoposide induced 2.4 mRNA
Synonyms: PIG8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13663
Homologene: 3588
Rtn4r
Name: reticulon 4 receptor
Synonyms: Nogo-66 receptor, NgR, NgR1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 65079
Homologene: 11299
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Cd274
Name: CD274 antigen
Synonyms: B7-H1, PD-L1, Pdcd1lg1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 60533
Homologene: 8560
Kirrel2
Name: kirre like nephrin family adhesion molecule 2
Synonyms: NEPH3, C330019F22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243911
Homologene: 35249
Srek1ip1
Name: splicing regulatory glutamine/lysine-rich protein 1interacting protein 1
Synonyms: 3110031B13Rik, Sfrs12ip1, Srsf12ip1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67288
Zfp667
Name: zinc finger protein 667
Synonyms: A830025F02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384763
Homologene: 23343
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Moxd1
Name: monooxygenase, DBH-like 1
Synonyms: 3230402N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59012
Homologene: 22904
Spp1
Name: secreted phosphoprotein 1
Synonyms: 44kDa bone phosphoprotein, bone sialoprotein 1, osteopontin, ETA-1, BNSP, minopontin, Opn, Opnl, Ric, Spp-1, OP, Apl-1, osteopontin-like protein, 2ar
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20750
Homologene: 20156
Kcnk2
Name: potassium channel, subfamily K, member 2
Synonyms: TREK-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16526
HGNC: HGNC:6277
Homologene: 7794
Scn4a
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: Nav1.4, mH2, SkM1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110880
Homologene: 283
Ckap4
Name: cytoskeleton-associated protein 4
Synonyms: CLIMP-63, P63, 5630400A09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216197
VEGA: 10
Homologene: 4970
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Arrb1
Name: arrestin, beta 1
Synonyms: 1200006I17Rik, beta-arrestin1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109689
HGNC: HGNC:711
Homologene: 2981
Actn2
Name: actinin alpha 2
Synonyms: 1110008F24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11472
HGNC: HGNC:164
Homologene: 31016
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: LOC380658, 4930503E15Rik, Gm1557
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: EG232970, Gm10102
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232970
Homologene: 109375
Shmt2
Name: serine hydroxymethyltransferase 2 (mitochondrial)
Synonyms: 2700043D08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108037
VEGA: 10
Homologene: 133984
Abca8b
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Zfp947
Name: zinc finger protein 947
Synonyms: Gm4769
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210853
Homologene: 133253
Cfap251
Name: cilia and flagella associated protein 251
Synonyms: 4930415N18Rik, 4933428F06Rik, Wdr66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269701
Homologene: 16964
Thap12
Name: THAP domain containing 12
Synonyms: 2900052B10Rik, Dap4, Prkrir
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72981
HGNC: HGNC:9440
Homologene: 37952
Itga1
Name: integrin alpha 1
Synonyms: CD49A, Vla1, E130012M19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109700
VEGA: 13
HGNC: HGNC:6134
Homologene: 57137
Gli3
Name: GLI-Kruppel family member GLI3
Synonyms: Bph, brachyphalangy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14634
HGNC: HGNC:4319
Homologene: 139
Lrit2
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Synonyms: A930010E21Rik, Lrrc22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239038
VEGA: 14
Homologene: 18292
Bok
Name: BCL2-related ovarian killer
Synonyms: matador, mtd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51800
HGNC: HGNC:1087
Homologene: 9632
Gbp3
Name: guanylate binding protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55932
Homologene: 137329
Tpte
Name: transmembrane phosphatase with tensin homology
Synonyms: Pten2, Vsp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234129
Homologene: 50411
Fbxo43
Name: F-box protein 43
Synonyms: 4930533G20Rik, XErp1 homolog, endogenous meiotic inhibitor 2, Emi2, early mitotic inhibitor 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78803
VEGA: 15
Homologene: 66393
Ccdc8
Name: coiled-coil domain containing 8
Synonyms: ENSMUSG00000041117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434130
Homologene: 49977
Nol4l
Name: nucleolar protein 4-like
Synonyms: LOC381396, 8430427H17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329540
Homologene: 129589
Col26a1
Name: collagen, type XXVI, alpha 1
Synonyms: Emu2, 9430032K24Rik, Collagen XXVI, Emid2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140709
Homologene: 136636
Zfp827
Name: zinc finger protein 827
Synonyms: 2810449M09Rik, D630040G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622675
Homologene: 45622
Slc2a12
Name: solute carrier family 2 (facilitated glucose transporter), member 12
Synonyms: GLUT-12, Glut12
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 353169
Homologene: 59263
Prl8a2
Name: prolactin family 8, subfamily a, member 2
Synonyms: D/tPRP, DPRP, mdPRP, Dtprp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13529
Homologene: 49230
Gata5
Name: GATA binding protein 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14464
Homologene: 32031
Trem1
Name: triggering receptor expressed on myeloid cells 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58217
Homologene: 10243
Zfand1
Name: zinc finger, AN1-type domain 1
Synonyms: 2310008M20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66361
Homologene: 6779
Upp2
Name: uridine phosphorylase 2
Synonyms: UDRPASE2, UPASE2, UP2, 1700124F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76654
Homologene: 12654
She
Name: src homology 2 domain-containing transforming protein E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214547
Homologene: 18186
Or7g21
Name: olfactory receptor family 7 subfamily G member 21
Synonyms: GA_x6K02T2PVTD-12857805-12858749, MOR152-3, Olfr836
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258557
HGNC: HGNC:8466
Homologene: 115507
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Ifi27l2b
Name: interferon, alpha-inducible protein 27 like 2B
Synonyms: 1810023F06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217845
Homologene: 137395
Or8g53
Name: olfactory receptor family 8 subfamily G member 53
Synonyms: GA_x6K02T2PVTD-33470347-33469403, MOR171-15, Olfr968
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258605
VEGA: 9
Homologene: 121532
Tcp10b
Name: t-complex protein 10b
Synonyms: T66B-a, D17Leh66ba, D17Leh66B, Tcp-10b, Tcp-10bt
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21462
Homologene: 83254
Malsu1
Name: mitochondrial assembly of ribosomal large subunit 1
Synonyms: 2410003K15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75593
Homologene: 16317
Or8g22
Name: olfactory receptor family 8 subfamily G member 22, pseudogene 1
Synonyms: GA_x6K02T2PVTD-32743332-32742397, MOR171-37, EG628171, Olfr936
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100503486
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 93,694,939 bp (GRCm38)
  • A to G, chromosome 1 at 135,877,691 bp (GRCm38)
  • T to C, chromosome 1 at 189,258,875 bp (GRCm38)
  • T to C, chromosome 2 at 58,567,530 bp (GRCm38)
  • C to A, chromosome 2 at 153,470,710 bp (GRCm38)
  • C to T, chromosome 2 at 156,127,014 bp (GRCm38)
  • G to A, chromosome 2 at 180,334,338 bp (GRCm38)
  • A to T, chromosome 3 at 10,341,088 bp (GRCm38)
  • A to G, chromosome 3 at 89,831,771 bp (GRCm38)
  • A to T, chromosome 3 at 142,565,287 bp (GRCm38)
  • CAAACTTTTAAACTT to CAAACTT, chromosome 4 at 6,416,543 bp (GRCm38)
  • T to C, chromosome 4 at 34,809,228 bp (GRCm38)
  • A to G, chromosome 5 at 104,440,521 bp (GRCm38)
  • A to G, chromosome 5 at 123,280,019 bp (GRCm38)
  • A to T, chromosome 5 at 136,748,348 bp (GRCm38)
  • C to T, chromosome 6 at 49,073,797 bp (GRCm38)
  • T to C, chromosome 6 at 85,005,018 bp (GRCm38)
  • T to A, chromosome 6 at 86,462,585 bp (GRCm38)
  • T to A, chromosome 7 at 6,305,323 bp (GRCm38)
  • T to A, chromosome 7 at 16,994,875 bp (GRCm38)
  • C to T, chromosome 7 at 24,624,302 bp (GRCm38)
  • T to A, chromosome 7 at 30,448,217 bp (GRCm38)
  • T to C, chromosome 7 at 98,715,393 bp (GRCm38)
  • T to C, chromosome 7 at 99,594,629 bp (GRCm38)
  • T to A, chromosome 7 at 102,194,966 bp (GRCm38)
  • T to A, chromosome 7 at 121,139,832 bp (GRCm38)
  • T to C, chromosome 8 at 22,355,481 bp (GRCm38)
  • A to G, chromosome 8 at 79,190,478 bp (GRCm38)
  • A to T, chromosome 8 at 109,556,151 bp (GRCm38)
  • C to T, chromosome 9 at 19,121,594 bp (GRCm38)
  • A to G, chromosome 9 at 36,785,974 bp (GRCm38)
  • A to T, chromosome 9 at 39,046,730 bp (GRCm38)
  • A to G, chromosome 9 at 39,772,218 bp (GRCm38)
  • G to T, chromosome 9 at 55,762,332 bp (GRCm38)
  • A to T, chromosome 9 at 108,583,712 bp (GRCm38)
  • T to A, chromosome 10 at 22,694,024 bp (GRCm38)
  • G to A, chromosome 10 at 24,279,864 bp (GRCm38)
  • C to T, chromosome 10 at 43,998,848 bp (GRCm38)
  • A to T, chromosome 10 at 84,533,538 bp (GRCm38)
  • A to G, chromosome 10 at 103,216,003 bp (GRCm38)
  • A to T, chromosome 10 at 127,520,093 bp (GRCm38)
  • C to T, chromosome 11 at 8,972,986 bp (GRCm38)
  • G to T, chromosome 11 at 78,155,194 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • G to T, chromosome 11 at 106,320,174 bp (GRCm38)
  • G to A, chromosome 11 at 107,632,215 bp (GRCm38)
  • A to T, chromosome 11 at 109,980,882 bp (GRCm38)
  • A to T, chromosome 12 at 103,451,855 bp (GRCm38)
  • T to C, chromosome 13 at 12,288,630 bp (GRCm38)
  • T to C, chromosome 13 at 15,726,735 bp (GRCm38)
  • C to G, chromosome 13 at 27,352,810 bp (GRCm38)
  • T to A, chromosome 13 at 27,352,811 bp (GRCm38)
  • G to T, chromosome 13 at 67,257,632 bp (GRCm38)
  • T to C, chromosome 13 at 104,837,456 bp (GRCm38)
  • A to T, chromosome 13 at 115,049,320 bp (GRCm38)
  • A to T, chromosome 14 at 26,770,368 bp (GRCm38)
  • A to T, chromosome 14 at 37,068,855 bp (GRCm38)
  • T to C, chromosome 15 at 36,162,473 bp (GRCm38)
  • T to C, chromosome 15 at 76,003,286 bp (GRCm38)
  • T to A, chromosome 16 at 11,660,571 bp (GRCm38)
  • T to A, chromosome 16 at 18,151,204 bp (GRCm38)
  • T to A, chromosome 16 at 95,377,329 bp (GRCm38)
  • C to T, chromosome 17 at 13,061,769 bp (GRCm38)
  • C to T, chromosome 17 at 22,145,874 bp (GRCm38)
  • A to G, chromosome 17 at 25,973,167 bp (GRCm38)
  • C to T, chromosome 17 at 30,959,173 bp (GRCm38)
  • C to A, chromosome 17 at 48,237,243 bp (GRCm38)
  • T to A, chromosome 19 at 29,380,371 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9099 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068998-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.