Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9099Btlr/Mmmh
Stock Number:
068998-MU
Citation ID:
RRID:MMRRC_068998-MU
Other Names:
R9099 (G1)
Major Collection:

Strain Information

Exoc6b
Name: exocyst complex component 6B
Synonyms: 4930569O18Rik, G430127E12Rik, Sec15b, Sec15l2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75914
Homologene: 44781
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Fam222b
Name: family with sequence similarity 222, member B
Synonyms: BC017647
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216971
Homologene: 10054
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 93,694,939 bp (GRCm38)
  • A to G, chromosome 1 at 135,877,691 bp (GRCm38)
  • T to C, chromosome 1 at 189,258,875 bp (GRCm38)
  • T to C, chromosome 2 at 58,567,530 bp (GRCm38)
  • C to A, chromosome 2 at 153,470,710 bp (GRCm38)
  • C to T, chromosome 2 at 156,127,014 bp (GRCm38)
  • G to A, chromosome 2 at 180,334,338 bp (GRCm38)
  • A to T, chromosome 3 at 10,341,088 bp (GRCm38)
  • A to G, chromosome 3 at 89,831,771 bp (GRCm38)
  • A to T, chromosome 3 at 142,565,287 bp (GRCm38)
  • CAAACTTTTAAACTT to CAAACTT, chromosome 4 at 6,416,543 bp (GRCm38)
  • T to C, chromosome 4 at 34,809,228 bp (GRCm38)
  • A to G, chromosome 5 at 104,440,521 bp (GRCm38)
  • A to G, chromosome 5 at 123,280,019 bp (GRCm38)
  • A to T, chromosome 5 at 136,748,348 bp (GRCm38)
  • C to T, chromosome 6 at 49,073,797 bp (GRCm38)
  • T to C, chromosome 6 at 85,005,018 bp (GRCm38)
  • T to A, chromosome 6 at 86,462,585 bp (GRCm38)
  • T to A, chromosome 7 at 6,305,323 bp (GRCm38)
  • T to A, chromosome 7 at 16,994,875 bp (GRCm38)
  • C to T, chromosome 7 at 24,624,302 bp (GRCm38)
  • T to A, chromosome 7 at 30,448,217 bp (GRCm38)
  • T to C, chromosome 7 at 98,715,393 bp (GRCm38)
  • T to C, chromosome 7 at 99,594,629 bp (GRCm38)
  • T to A, chromosome 7 at 102,194,966 bp (GRCm38)
  • T to A, chromosome 7 at 121,139,832 bp (GRCm38)
  • T to C, chromosome 8 at 22,355,481 bp (GRCm38)
  • A to G, chromosome 8 at 79,190,478 bp (GRCm38)
  • A to T, chromosome 8 at 109,556,151 bp (GRCm38)
  • C to T, chromosome 9 at 19,121,594 bp (GRCm38)
  • A to G, chromosome 9 at 36,785,974 bp (GRCm38)
  • A to T, chromosome 9 at 39,046,730 bp (GRCm38)
  • A to G, chromosome 9 at 39,772,218 bp (GRCm38)
  • G to T, chromosome 9 at 55,762,332 bp (GRCm38)
  • A to T, chromosome 9 at 108,583,712 bp (GRCm38)
  • T to A, chromosome 10 at 22,694,024 bp (GRCm38)
  • G to A, chromosome 10 at 24,279,864 bp (GRCm38)
  • C to T, chromosome 10 at 43,998,848 bp (GRCm38)
  • A to T, chromosome 10 at 84,533,538 bp (GRCm38)
  • A to G, chromosome 10 at 103,216,003 bp (GRCm38)
  • A to T, chromosome 10 at 127,520,093 bp (GRCm38)
  • C to T, chromosome 11 at 8,972,986 bp (GRCm38)
  • G to T, chromosome 11 at 78,155,194 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • G to T, chromosome 11 at 106,320,174 bp (GRCm38)
  • G to A, chromosome 11 at 107,632,215 bp (GRCm38)
  • A to T, chromosome 11 at 109,980,882 bp (GRCm38)
  • A to T, chromosome 12 at 103,451,855 bp (GRCm38)
  • T to C, chromosome 13 at 12,288,630 bp (GRCm38)
  • T to C, chromosome 13 at 15,726,735 bp (GRCm38)
  • C to G, chromosome 13 at 27,352,810 bp (GRCm38)
  • T to A, chromosome 13 at 27,352,811 bp (GRCm38)
  • G to T, chromosome 13 at 67,257,632 bp (GRCm38)
  • T to C, chromosome 13 at 104,837,456 bp (GRCm38)
  • A to T, chromosome 13 at 115,049,320 bp (GRCm38)
  • A to T, chromosome 14 at 26,770,368 bp (GRCm38)
  • A to T, chromosome 14 at 37,068,855 bp (GRCm38)
  • T to C, chromosome 15 at 36,162,473 bp (GRCm38)
  • T to C, chromosome 15 at 76,003,286 bp (GRCm38)
  • T to A, chromosome 16 at 11,660,571 bp (GRCm38)
  • T to A, chromosome 16 at 18,151,204 bp (GRCm38)
  • T to A, chromosome 16 at 95,377,329 bp (GRCm38)
  • C to T, chromosome 17 at 13,061,769 bp (GRCm38)
  • C to T, chromosome 17 at 22,145,874 bp (GRCm38)
  • A to G, chromosome 17 at 25,973,167 bp (GRCm38)
  • C to T, chromosome 17 at 30,959,173 bp (GRCm38)
  • C to A, chromosome 17 at 48,237,243 bp (GRCm38)
  • T to A, chromosome 19 at 29,380,371 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9099 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068998-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.