Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9134Btlr/Mmmh
Stock Number:
069011-MU
Citation ID:
RRID:MMRRC_069011-MU
Other Names:
R9134 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Lrrc41
Name: leucine rich repeat containing 41
Synonyms: D730026A16Rik, MUF1, D630045E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230654
Homologene: 4645
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Syt3
Name: synaptotagmin III
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20981
Homologene: 9617
Fam117a
Name: family with sequence similarity 117, member A
Synonyms: 5730593F17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215512
Homologene: 12775
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Ints1
Name: integrator complex subunit 1
Synonyms: 1110015K06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68510
Homologene: 53111
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Hspb8
Name: heat shock protein 8
Synonyms: HSP22, HSP20-like, D5Ucla4, E2IG1, H11, Cryac, H11K
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80888
Homologene: 8654
Ccdc138
Name: coiled-coil domain containing 138
Synonyms: 6230424H07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76138
VEGA: 10
Homologene: 44912
Robo2
Name: roundabout guidance receptor 2
Synonyms: 9430089E08Rik, D230004I22Rik, 2600013A04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268902
Homologene: 43188
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Zranb1
Name: zinc finger, RAN-binding domain containing 1
Synonyms: D7Wsu87e, 9330160G10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 360216
Homologene: 9728
Rex2
Name: reduced expression 2
Synonyms: Gm13138
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100043034
Homologene: 133076
Pcmt1
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase 1
Synonyms: protein carboxyl methyltransferase, PIMT
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18537
HGNC: HGNC:8728
Homologene: 135759
Vps26b
Name: VPS26 retromer complex component B
Synonyms: 1810012I05Rik, 2310075A12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69091
VEGA: 9
Homologene: 3601
Trappc6b
Name: trafficking protein particle complex 6B
Synonyms: 5830498C14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78232
VEGA: 12
Homologene: 42466
Arhgdia
Name: Rho GDP dissociation inhibitor alpha
Synonyms: 5330430M07Rik, Rho-GDI, Rho GDIalpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192662
HGNC: HGNC:678
Homologene: 908
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: 1110014E10Rik, D530031C13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320817
VEGA: 12
Homologene: 86351
Wdcp
Name: WD repeat and coiled coil containing
Synonyms: BC068281
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238037
VEGA: 12
Homologene: 49822
Tmc2
Name: transmembrane channel-like gene family 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192140
Homologene: 25877
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Vwa3a
Name: von Willebrand factor A domain containing 3A
Synonyms: E030013G06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233813
Homologene: 18607
Enkur
Name: enkurin, TRPC channel interacting protein
Synonyms: 4933434I06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71233
Homologene: 17022
Insr
Name: insulin receptor
Synonyms: IR, CD220, 4932439J01Rik, D630014A15Rik, IR-B, IR-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Srgap1
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: 4930572H05Rik, Arhgap13
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117600
Homologene: 56898
Ino80c
Name: INO80 complex subunit C
Synonyms: D030070L09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225280
Homologene: 45426
Pde8a
Name: phosphodiesterase 8A
Synonyms: Pde8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18584
HGNC: HGNC:8793
Homologene: 1957
Mndal
Name: myeloid nuclear differentiation antigen like
Synonyms: Ifi212
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100040462
Homologene: 115929
Nme4
Name: NME/NM23 nucleoside diphosphate kinase 4
Synonyms: NM23-M4, 5730493H09Rik, 2810024O08Rik, 2610027N22Rik, non-metastatic cells 4, protein expressed in
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56520
HGNC: HGNC:7852
Homologene: 3673
Xkr4
Name: X-linked Kx blood group related 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 497097
Homologene: 45848
Vmn2r120
Name: vomeronasal 2, receptor 120
Synonyms: EG224916
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224916
Bpifb9b
Name: BPI fold containing family B, member 9B
Synonyms: OTTMUSG00000015915, 5430413K10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433492
Homologene: 128535
Or14c39
Name: olfactory receptor family 14 subfamily C member 39
Synonyms: GA_x6K02T2NHDJ-9425121-9424195, MOR220-2, Olfr292
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258613
Homologene: 115526
Fam228a
Name: family with sequence similarity 228, member A
Synonyms: 4930417G10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74855
VEGA: 12
Homologene: 54902
Pira13
Name: paired-Ig-like receptor A13
Synonyms: ENSMUSG00000074419, Gm15448
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041146
Homologene: 134028
Ap1m1
Name: adaptor-related protein complex AP-1, mu subunit 1
Synonyms: AP47, mu1A, [m]1A, Adtm1A, Cltnm
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11767
Homologene: 4017
Or3a1
Name: olfactory receptor family 3 subfamily A member 1
Synonyms: GA_x6K02T2P1NL-4467421-4466474, MOR255-5, Olfr410
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258702
HGNC: HGNC:8282
Homologene: 68262
Pde4c
Name: phosphodiesterase 4C, cAMP specific
Synonyms: dunce, Dpde1, E130301F19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110385
HGNC: HGNC:8782
Homologene: 20256
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 3110012E06Rik, 4930438C08Rik, 4930589M24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75906
Homologene: 11600
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Cd84
Name: CD84 antigen
Synonyms: CDw84, SLAMF5, A130013D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12523
HGNC: HGNC:1704
Homologene: 48249
Tll1
Name: tolloid-like
Synonyms: Tll-1, b2b2476Clo
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21892
Homologene: 49202
Lrriq3
Name: leucine-rich repeats and IQ motif containing 3
Synonyms: 4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74435
Homologene: 23668
Dph7
Name: diphthamine biosynethesis 7
Synonyms: 2810443J12Rik, Wdr85
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67228
Homologene: 5432
Fpr-rs7
Name: formyl peptide receptor, related sequence 7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 321021
Cdk20
Name: cyclin dependent kinase 20
Synonyms: 4932702G04Rik, Ccrk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105278
VEGA: 13
Homologene: 8109
Cby3
Name: chibby family member 3
Synonyms: 1700121K02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76653
Homologene: 67734
Tfec
Name: transcription factor EC
Synonyms: TFEC, bHLHe34, Tcfec
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21426
Homologene: 32148
Prr23a1
Name: proline rich 23A, member 1
Synonyms: Gm6400, Prr23a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 623166
Homologene: 67036
Vmn1r2
Name: vomeronasal 1 receptor 2
Synonyms: Gm11776
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100312470
Homologene: 128342
Csl
Name: citrate synthase like
Synonyms: 1700007H16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71832
VEGA: 10
HGNC: HGNC:2422
Homologene: 7131
Trav6-2
Name: T cell receptor alpha variable 6-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 436539
Or5b114
Name: olfactory receptor family 5 subfamily B member 114
Synonyms: GA_x6K02T2RE5P-3706029-3706953, MOR202-21, Or5b114-ps1, Olfr1468-ps1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258192
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 3,670,637 bp (GRCm38)
  • T to A, chromosome 1 at 171,851,846 bp (GRCm38)
  • T to C, chromosome 1 at 173,871,530 bp (GRCm38)
  • T to C, chromosome 2 at 21,180,968 bp (GRCm38)
  • C to T, chromosome 2 at 24,971,708 bp (GRCm38)
  • T to C, chromosome 2 at 130,232,401 bp (GRCm38)
  • T to C, chromosome 2 at 154,309,521 bp (GRCm38)
  • A to G, chromosome 3 at 53,654,900 bp (GRCm38)
  • T to C, chromosome 3 at 155,114,546 bp (GRCm38)
  • T to A, chromosome 4 at 3,172,884 bp (GRCm38)
  • C to A, chromosome 4 at 116,088,585 bp (GRCm38)
  • T to A, chromosome 4 at 139,400,444 bp (GRCm38)
  • C to G, chromosome 4 at 147,058,186 bp (GRCm38)
  • A to G, chromosome 5 at 116,409,488 bp (GRCm38)
  • G to A, chromosome 5 at 139,757,596 bp (GRCm38)
  • T to A, chromosome 6 at 16,835,327 bp (GRCm38)
  • T to C, chromosome 7 at 3,822,183 bp (GRCm38)
  • A to G, chromosome 7 at 44,393,367 bp (GRCm38)
  • A to G, chromosome 7 at 56,182,429 bp (GRCm38)
  • C to T, chromosome 7 at 81,332,871 bp (GRCm38)
  • C to A, chromosome 7 at 86,695,380 bp (GRCm38)
  • A to G, chromosome 7 at 105,755,703 bp (GRCm38)
  • T to C, chromosome 7 at 120,778,436 bp (GRCm38)
  • A to G, chromosome 7 at 132,950,157 bp (GRCm38)
  • G to A, chromosome 8 at 3,258,413 bp (GRCm38)
  • A to T, chromosome 8 at 64,016,167 bp (GRCm38)
  • G to T, chromosome 8 at 70,748,511 bp (GRCm38)
  • A to G, chromosome 8 at 72,240,069 bp (GRCm38)
  • A to G, chromosome 8 at 90,933,126 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to C, chromosome 9 at 27,009,929 bp (GRCm38)
  • T to C, chromosome 9 at 98,842,882 bp (GRCm38)
  • A to T, chromosome 10 at 7,644,443 bp (GRCm38)
  • T to G, chromosome 10 at 53,697,248 bp (GRCm38)
  • T to G, chromosome 10 at 58,538,280 bp (GRCm38)
  • T to A, chromosome 10 at 99,758,375 bp (GRCm38)
  • A to G, chromosome 10 at 122,047,222 bp (GRCm38)
  • A to C, chromosome 11 at 50,359,326 bp (GRCm38)
  • A to G, chromosome 11 at 74,334,844 bp (GRCm38)
  • G to A, chromosome 11 at 80,133,105 bp (GRCm38)
  • C to A, chromosome 11 at 95,380,919 bp (GRCm38)
  • T to C, chromosome 11 at 118,088,146 bp (GRCm38)
  • A to T, chromosome 11 at 120,579,566 bp (GRCm38)
  • T to C, chromosome 12 at 4,715,686 bp (GRCm38)
  • C to A, chromosome 12 at 4,851,533 bp (GRCm38)
  • T to A, chromosome 12 at 5,010,351 bp (GRCm38)
  • T to A, chromosome 12 at 59,050,374 bp (GRCm38)
  • T to A, chromosome 13 at 49,701,847 bp (GRCm38)
  • T to A, chromosome 13 at 64,433,092 bp (GRCm38)
  • TCTGCTGC to TCTGCTGCTGC, chromosome 14 at 31,174,680 bp (GRCm38)
  • T to A, chromosome 14 at 52,667,652 bp (GRCm38)
  • T to C, chromosome 15 at 8,199,232 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • A to G, chromosome 16 at 73,906,850 bp (GRCm38)
  • G to A, chromosome 16 at 91,869,626 bp (GRCm38)
  • A to T, chromosome 17 at 20,114,063 bp (GRCm38)
  • G to T, chromosome 17 at 26,095,415 bp (GRCm38)
  • A to G, chromosome 17 at 57,525,093 bp (GRCm38)
  • T to C, chromosome 18 at 24,121,708 bp (GRCm38)
  • G to T, chromosome 19 at 13,375,249 bp (GRCm38)
  • G to T, chromosome 19 at 37,296,162 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9134 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069011-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.