Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9206Btlr/Mmmh
Stock Number:
069046-MU
Citation ID:
RRID:MMRRC_069046-MU
Other Names:
R9206 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Atl3
Name: atlastin GTPase 3
Synonyms: 4633402C03Rik, 5730596K20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109168
VEGA: 19
Homologene: 9149
Sptan1
Name: spectrin alpha, non-erythrocytic 1
Synonyms: alpha-fodrin, Spna-2, 2610027H02Rik, Spna2, alphaII-spectrin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20740
Homologene: 2353
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 53,501,598 bp (GRCm38)
  • A to G, chromosome 1 at 59,185,247 bp (GRCm38)
  • A to T, chromosome 1 at 59,552,426 bp (GRCm38)
  • G to T, chromosome 1 at 93,051,480 bp (GRCm38)
  • A to T, chromosome 1 at 153,250,451 bp (GRCm38)
  • A to T, chromosome 1 at 185,317,949 bp (GRCm38)
  • A to T, chromosome 1 at 192,101,595 bp (GRCm38)
  • A to T, chromosome 2 at 25,194,963 bp (GRCm38)
  • A to T, chromosome 2 at 30,030,712 bp (GRCm38)
  • A to G, chromosome 2 at 62,777,603 bp (GRCm38)
  • A to T, chromosome 2 at 65,717,787 bp (GRCm38)
  • A to T, chromosome 2 at 91,682,061 bp (GRCm38)
  • A to G, chromosome 2 at 112,092,065 bp (GRCm38)
  • C to A, chromosome 2 at 166,941,265 bp (GRCm38)
  • G to C, chromosome 3 at 39,009,241 bp (GRCm38)
  • T to A, chromosome 3 at 64,559,611 bp (GRCm38)
  • A to C, chromosome 3 at 93,146,944 bp (GRCm38)
  • A to T, chromosome 4 at 58,875,444 bp (GRCm38)
  • A to G, chromosome 4 at 63,834,213 bp (GRCm38)
  • C to G, chromosome 4 at 75,954,078 bp (GRCm38)
  • A to T, chromosome 4 at 98,539,073 bp (GRCm38)
  • A to G, chromosome 4 at 123,684,132 bp (GRCm38)
  • A to T, chromosome 4 at 126,750,248 bp (GRCm38)
  • T to C, chromosome 5 at 6,772,154 bp (GRCm38)
  • A to G, chromosome 5 at 28,352,586 bp (GRCm38)
  • A to T, chromosome 6 at 13,082,431 bp (GRCm38)
  • A to T, chromosome 6 at 32,517,444 bp (GRCm38)
  • A to G, chromosome 6 at 41,059,690 bp (GRCm38)
  • C to A, chromosome 6 at 56,897,808 bp (GRCm38)
  • A to G, chromosome 6 at 64,729,729 bp (GRCm38)
  • T to C, chromosome 6 at 92,038,210 bp (GRCm38)
  • A to G, chromosome 6 at 126,966,969 bp (GRCm38)
  • A to T, chromosome 7 at 12,811,158 bp (GRCm38)
  • C to A, chromosome 7 at 26,558,231 bp (GRCm38)
  • A to T, chromosome 7 at 27,322,925 bp (GRCm38)
  • A to G, chromosome 7 at 103,768,271 bp (GRCm38)
  • A to G, chromosome 7 at 105,559,520 bp (GRCm38)
  • T to C, chromosome 9 at 38,189,824 bp (GRCm38)
  • A to G, chromosome 9 at 57,682,300 bp (GRCm38)
  • T to A, chromosome 9 at 62,849,183 bp (GRCm38)
  • T to A, chromosome 9 at 77,651,107 bp (GRCm38)
  • T to C, chromosome 9 at 119,616,761 bp (GRCm38)
  • A to G, chromosome 10 at 34,297,572 bp (GRCm38)
  • A to G, chromosome 10 at 70,553,039 bp (GRCm38)
  • A to G, chromosome 10 at 81,509,390 bp (GRCm38)
  • A to G, chromosome 10 at 127,243,358 bp (GRCm38)
  • T to C, chromosome 11 at 62,882,016 bp (GRCm38)
  • T to C, chromosome 11 at 97,032,136 bp (GRCm38)
  • T to C, chromosome 11 at 99,149,069 bp (GRCm38)
  • T to C, chromosome 11 at 101,274,056 bp (GRCm38)
  • C to T, chromosome 12 at 112,178,046 bp (GRCm38)
  • A to T, chromosome 13 at 22,187,231 bp (GRCm38)
  • A to C, chromosome 14 at 37,080,548 bp (GRCm38)
  • T to G, chromosome 14 at 50,925,668 bp (GRCm38)
  • T to A, chromosome 14 at 55,750,135 bp (GRCm38)
  • C to T, chromosome 14 at 73,177,060 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • C to A, chromosome 16 at 20,389,389 bp (GRCm38)
  • T to C, chromosome 16 at 76,292,728 bp (GRCm38)
  • T to C, chromosome 16 at 87,400,410 bp (GRCm38)
  • A to G, chromosome 16 at 88,671,428 bp (GRCm38)
  • A to T, chromosome 17 at 17,970,869 bp (GRCm38)
  • A to G, chromosome 17 at 23,175,577 bp (GRCm38)
  • A to G, chromosome 17 at 45,509,404 bp (GRCm38)
  • T to C, chromosome 18 at 7,403,327 bp (GRCm38)
  • T to A, chromosome 18 at 42,314,098 bp (GRCm38)
  • A to G, chromosome 19 at 7,510,082 bp (GRCm38)
  • T to C, chromosome 19 at 38,836,998 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9206 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069046-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.