Strain Name:
C57BL/6J-MtgxR9206Btlr/Mmmh
Stock Number:
069046-MU
Citation ID:
RRID:MMRRC_069046-MU
Other Names:
R9206 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Atl3
Name: atlastin GTPase 3
Synonyms: 4633402C03Rik, 5730596K20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109168
VEGA: 19
Homologene: 9149
Sptan1
Name: spectrin alpha, non-erythrocytic 1
Synonyms: alpha-fodrin, Spna-2, 2610027H02Rik, Spna2, alphaII-spectrin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20740
Homologene: 2353
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Rbm27
Name: RNA binding motif protein 27
Synonyms: Psc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225432
VEGA: 18
Homologene: 35410
Cse1l
Name: chromosome segregation 1 like
Synonyms: Cas, Capts, 2610100P18Rik, Xpo2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110750
HGNC: HGNC:2431
Homologene: 1006
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Atg13
Name: autophagy related 13
Synonyms: 1110053A20Rik, D2Ertd391e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51897
Homologene: 32229
Abcc5
Name: ATP-binding cassette, sub-family C member 5
Synonyms: Mrp5, Abcc5b, Abcc5a, 2900011L11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Nt5c3
Name: 5'-nucleotidase, cytosolic III
Synonyms: p36, lupin, Umph-1, 2610206B05Rik, 1600024P05Rik, PN-1, cN-III, PSN1, PN-I, Umph1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107569
Homologene: 9534
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Cdhr1
Name: cadherin-related family member 1
Synonyms: Prcad, Pcdh21
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 170677
VEGA: 14
Homologene: 13215
Atoh1
Name: atonal bHLH transcription factor 1
Synonyms: Math1, Hath1, bHLHa14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11921
HGNC: HGNC:797
Homologene: 31297
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Kif26a
Name: kinesin family member 26A
Synonyms: N-11 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668303
Homologene: 18970
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
D6Wsu163e
Name: DNA segment, Chr 6, Wayne State University 163, expressed
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28040
HGNC: HGNC:1184
Homologene: 10685
Nrip1
Name: nuclear receptor interacting protein 1
Synonyms: RIP140, 6030458L20Rik, 8430438I05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268903
HGNC: HGNC:8001
Homologene: 2606
Rbm33
Name: RNA binding motif protein 33
Synonyms: 6430512A10Rik, 3200001K10Rik, Prr8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381626
Homologene: 137386
Apex1
Name: apurinic/apyrimidinic endonuclease 1
Synonyms: Ref-1, HAP1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11792
HGNC: HGNC:587
Homologene: 1241
Gna15
Name: guanine nucleotide binding protein, alpha 15
Synonyms: Galpha15, G[a]15
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14676
HGNC: HGNC:4383
Homologene: 1563
Tvp23b
Name: trans-golgi network vesicle protein 23B
Synonyms: 1810036I24Rik, Fam18b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67510
Homologene: 128511
Nop9
Name: NOP9 nucleolar protein
Synonyms: 2610027L16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67842
Homologene: 41678
Fam13c
Name: family with sequence similarity 13, member C
Synonyms: C030038O19Rik, 1200015N20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71721
Homologene: 11490
Mpp7
Name: membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms: 5430426E14Rik, 2810038M04Rik, LOC381166, 1110068J02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75739
VEGA: 18
Homologene: 1455
Ccr7
Name: C-C motif chemokine receptor 7
Synonyms: EBI1, Ebi1h, CD197, Cmkbr7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12775
HGNC: HGNC:1608
Homologene: 1387
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Tnfsf8
Name: tumor necrosis factor (ligand) superfamily, member 8
Synonyms: Cd30L, CD153, CD30LG
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21949
Homologene: 950
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Vmn2r6
Name: vomeronasal 2, receptor 6
Synonyms: EG620718, EG667069
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 667069
Homologene: 129754
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Kif1a
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207618
Homologene: 52304
Cyp1a2
Name: cytochrome P450, family 1, subfamily a, polypeptide 2
Synonyms: P450-3, CP12, aromatic compound inducible
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13077
VEGA: 9
HGNC: HGNC:2596
Homologene: 68082
Fgd5
Name: FYVE, RhoGEF and PH domain containing 5
Synonyms: ZFYVE23, C330025N11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232237
Homologene: 27798
Ncdn
Name: neurochondrin
Synonyms: neurochondrin-2, neurochondrin-1, norbin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26562
Homologene: 8064
Wnk4
Name: WNK lysine deficient protein kinase 4
Synonyms: 2010002J11Rik, Prkwnk4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69847
Homologene: 13020
Zfp329
Name: zinc finger protein 329
Synonyms: 2810439M05Rik, 4632409L22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67230
Homologene: 23459
Apbb1
Name: amyloid beta precursor protein binding family B member 1
Synonyms: Fe65, Rir
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11785
HGNC: HGNC:581
Homologene: 898
Gm973
Name: predicted gene 973
Synonyms: LOC381260
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381260
Homologene: 124277
Kcnh7
Name: potassium voltage-gated channel, subfamily H (eag-related), member 7
Synonyms: Kv11.3, erg3, 9330137I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170738
Homologene: 13249
Aars2
Name: alanyl-tRNA synthetase 2, mitochondrial
Synonyms: Aarsl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224805
VEGA: 17
Homologene: 56897
Or52a5b
Name: olfactory receptor family 52 subfamily A member 5B
Synonyms: 3'[b]3, MOR22-2, GA_x6K02T2PBJ9-6494485-6493535, Olfr69
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18370
Homologene: 128070
Rcbtb2
Name: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
Synonyms: 2810420M18Rik, 2610028E02Rik, Chc1l, Rc/btb2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105670
HGNC: HGNC:1914
Homologene: 970
Klhl31
Name: kelch-like 31
Synonyms: D930047P17Rik, Kbtbd1, 9830147P19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244923
Homologene: 27819
Or4f61
Name: olfactory receptor family 4 subfamily F member 61
Synonyms: GA_x6K02T2Q125-73139026-73138088, MOR245-2, Olfr1314
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258442
Homologene: 121538
Scrn2
Name: secernin 2
Synonyms: SES2, D11Moh48
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217140
Homologene: 26698
Rcor3
Name: REST corepressor 3
Synonyms: E130101E15Rik, 4921514E24Rik, C730034D20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214742
Homologene: 135671
Tspyl4
Name: TSPY-like 4
Synonyms: B230210I21Rik, 2610102M01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72480
Homologene: 15872
Tmem106b
Name: transmembrane protein 106B
Synonyms: 6430519M21Rik, 5830455K21Rik, 2310036D22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71900
Homologene: 56806
Tbc1d12
Name: TBC1D12: TBC1 domain family, member 12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 209478
VEGA: 19
Homologene: 50835
Vmn1r192
Name: vomeronasal 1 receptor 192
Synonyms: V1ri1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252907
Homologene: 110880
Cln6
Name: ceroid-lipofuscinosis, neuronal 6
Synonyms: 1810065L06Rik, D9Bwg1455e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76524
HGNC: HGNC:2077
Homologene: 9898
Crnn
Name: cornulin
Synonyms: LOC381457
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381457
HGNC: HGNC:1230
Homologene: 9416
Zfp40
Name: zinc finger protein 40
Synonyms: NTfin12, Zfp-40
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22700
Homologene: 136312
Krtap27-1
Name: keratin associated protein 27-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239933
Homologene: 90787
Tor4a
Name: torsin family 4, member A
Synonyms: A830007P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227612
Homologene: 17140
Fpr3
Name: formyl peptide receptor 3
Synonyms: Lxa4r, LXA4-R, Fprl1, Fpr-rs1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14294
Trbv4
Name: T cell receptor beta, variable 10
Synonyms: Tcrb-V10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124660
Or8c14-ps1
Name: olfactory receptor family 8 subfamily C member 14, pseudogene 1
Synonyms: GA_x6K02T2PVTD-31869885-31870831, MOR170-12, Olfr892-ps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257911
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 53,501,598 bp (GRCm38)
  • A to G, chromosome 1 at 59,185,247 bp (GRCm38)
  • A to T, chromosome 1 at 59,552,426 bp (GRCm38)
  • G to T, chromosome 1 at 93,051,480 bp (GRCm38)
  • A to T, chromosome 1 at 153,250,451 bp (GRCm38)
  • A to T, chromosome 1 at 185,317,949 bp (GRCm38)
  • A to T, chromosome 1 at 192,101,595 bp (GRCm38)
  • A to T, chromosome 2 at 25,194,963 bp (GRCm38)
  • A to T, chromosome 2 at 30,030,712 bp (GRCm38)
  • A to G, chromosome 2 at 62,777,603 bp (GRCm38)
  • A to T, chromosome 2 at 65,717,787 bp (GRCm38)
  • A to T, chromosome 2 at 91,682,061 bp (GRCm38)
  • A to G, chromosome 2 at 112,092,065 bp (GRCm38)
  • C to A, chromosome 2 at 166,941,265 bp (GRCm38)
  • G to C, chromosome 3 at 39,009,241 bp (GRCm38)
  • T to A, chromosome 3 at 64,559,611 bp (GRCm38)
  • A to C, chromosome 3 at 93,146,944 bp (GRCm38)
  • A to T, chromosome 4 at 58,875,444 bp (GRCm38)
  • A to G, chromosome 4 at 63,834,213 bp (GRCm38)
  • C to G, chromosome 4 at 75,954,078 bp (GRCm38)
  • A to T, chromosome 4 at 98,539,073 bp (GRCm38)
  • A to G, chromosome 4 at 123,684,132 bp (GRCm38)
  • A to T, chromosome 4 at 126,750,248 bp (GRCm38)
  • T to C, chromosome 5 at 6,772,154 bp (GRCm38)
  • A to G, chromosome 5 at 28,352,586 bp (GRCm38)
  • A to T, chromosome 6 at 13,082,431 bp (GRCm38)
  • A to T, chromosome 6 at 32,517,444 bp (GRCm38)
  • A to G, chromosome 6 at 41,059,690 bp (GRCm38)
  • C to A, chromosome 6 at 56,897,808 bp (GRCm38)
  • A to G, chromosome 6 at 64,729,729 bp (GRCm38)
  • T to C, chromosome 6 at 92,038,210 bp (GRCm38)
  • A to G, chromosome 6 at 126,966,969 bp (GRCm38)
  • A to T, chromosome 7 at 12,811,158 bp (GRCm38)
  • C to A, chromosome 7 at 26,558,231 bp (GRCm38)
  • A to T, chromosome 7 at 27,322,925 bp (GRCm38)
  • A to G, chromosome 7 at 103,768,271 bp (GRCm38)
  • A to G, chromosome 7 at 105,559,520 bp (GRCm38)
  • T to C, chromosome 9 at 38,189,824 bp (GRCm38)
  • A to G, chromosome 9 at 57,682,300 bp (GRCm38)
  • T to A, chromosome 9 at 62,849,183 bp (GRCm38)
  • T to A, chromosome 9 at 77,651,107 bp (GRCm38)
  • T to C, chromosome 9 at 119,616,761 bp (GRCm38)
  • A to G, chromosome 10 at 34,297,572 bp (GRCm38)
  • A to G, chromosome 10 at 70,553,039 bp (GRCm38)
  • A to G, chromosome 10 at 81,509,390 bp (GRCm38)
  • A to G, chromosome 10 at 127,243,358 bp (GRCm38)
  • T to C, chromosome 11 at 62,882,016 bp (GRCm38)
  • T to C, chromosome 11 at 97,032,136 bp (GRCm38)
  • T to C, chromosome 11 at 99,149,069 bp (GRCm38)
  • T to C, chromosome 11 at 101,274,056 bp (GRCm38)
  • C to T, chromosome 12 at 112,178,046 bp (GRCm38)
  • A to T, chromosome 13 at 22,187,231 bp (GRCm38)
  • A to C, chromosome 14 at 37,080,548 bp (GRCm38)
  • T to G, chromosome 14 at 50,925,668 bp (GRCm38)
  • T to A, chromosome 14 at 55,750,135 bp (GRCm38)
  • C to T, chromosome 14 at 73,177,060 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • C to A, chromosome 16 at 20,389,389 bp (GRCm38)
  • T to C, chromosome 16 at 76,292,728 bp (GRCm38)
  • T to C, chromosome 16 at 87,400,410 bp (GRCm38)
  • A to G, chromosome 16 at 88,671,428 bp (GRCm38)
  • A to T, chromosome 17 at 17,970,869 bp (GRCm38)
  • A to G, chromosome 17 at 23,175,577 bp (GRCm38)
  • A to G, chromosome 17 at 45,509,404 bp (GRCm38)
  • T to C, chromosome 18 at 7,403,327 bp (GRCm38)
  • T to A, chromosome 18 at 42,314,098 bp (GRCm38)
  • A to G, chromosome 19 at 7,510,082 bp (GRCm38)
  • T to C, chromosome 19 at 38,836,998 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9206 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069046-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.