Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9217Btlr/Mmmh
Stock Number:
069053-MU
Citation ID:
RRID:MMRRC_069053-MU
Other Names:
R9217 (G1)
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Amigo1
Name: adhesion molecule with Ig like domain 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229715
Homologene: 46421
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Wdr47
Name: WD repeat domain 47
Synonyms: 1810073M12Rik, nemitin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99512
Homologene: 8984
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Terf1
Name: telomeric repeat binding factor 1
Synonyms: Trf1, Trbf1, Pin2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21749
Homologene: 7570
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 15,813,071 bp (GRCm38)
  • T to A, chromosome 1 at 17,097,408 bp (GRCm38)
  • A to G, chromosome 1 at 131,158,235 bp (GRCm38)
  • A to G, chromosome 1 at 156,625,332 bp (GRCm38)
  • A to T, chromosome 1 at 162,920,477 bp (GRCm38)
  • A to T, chromosome 2 at 24,839,566 bp (GRCm38)
  • T to C, chromosome 2 at 32,213,402 bp (GRCm38)
  • A to T, chromosome 2 at 58,047,998 bp (GRCm38)
  • A to T, chromosome 2 at 74,657,765 bp (GRCm38)
  • A to T, chromosome 2 at 76,744,045 bp (GRCm38)
  • T to A, chromosome 3 at 106,406,095 bp (GRCm38)
  • T to A, chromosome 3 at 108,188,628 bp (GRCm38)
  • T to A, chromosome 3 at 108,618,574 bp (GRCm38)
  • C to T, chromosome 3 at 125,724,736 bp (GRCm38)
  • T to C, chromosome 3 at 152,218,236 bp (GRCm38)
  • G to A, chromosome 4 at 15,930,969 bp (GRCm38)
  • A to T, chromosome 4 at 155,540,576 bp (GRCm38)
  • T to C, chromosome 5 at 114,610,844 bp (GRCm38)
  • C to T, chromosome 5 at 120,600,642 bp (GRCm38)
  • A to G, chromosome 5 at 123,579,378 bp (GRCm38)
  • C to A, chromosome 5 at 123,954,407 bp (GRCm38)
  • G to A, chromosome 5 at 124,076,027 bp (GRCm38)
  • T to A, chromosome 6 at 17,846,272 bp (GRCm38)
  • T to C, chromosome 6 at 30,958,535 bp (GRCm38)
  • T to C, chromosome 6 at 92,831,986 bp (GRCm38)
  • T to C, chromosome 6 at 149,144,165 bp (GRCm38)
  • T to C, chromosome 7 at 4,510,382 bp (GRCm38)
  • A to T, chromosome 7 at 24,746,125 bp (GRCm38)
  • C to A, chromosome 7 at 51,593,667 bp (GRCm38)
  • C to T, chromosome 7 at 96,885,439 bp (GRCm38)
  • A to T, chromosome 7 at 120,388,216 bp (GRCm38)
  • A to C, chromosome 7 at 127,866,632 bp (GRCm38)
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp (GRCm38)
  • G to A, chromosome 8 at 53,513,592 bp (GRCm38)
  • T to A, chromosome 8 at 125,911,288 bp (GRCm38)
  • A to G, chromosome 9 at 38,367,972 bp (GRCm38)
  • A to T, chromosome 9 at 73,578,433 bp (GRCm38)
  • T to C, chromosome 9 at 110,827,496 bp (GRCm38)
  • T to C, chromosome 9 at 119,072,655 bp (GRCm38)
  • T to A, chromosome 10 at 5,349,324 bp (GRCm38)
  • T to A, chromosome 10 at 52,261,932 bp (GRCm38)
  • T to A, chromosome 10 at 115,587,444 bp (GRCm38)
  • A to G, chromosome 11 at 51,726,504 bp (GRCm38)
  • C to T, chromosome 11 at 69,235,952 bp (GRCm38)
  • A to T, chromosome 11 at 73,136,110 bp (GRCm38)
  • T to C, chromosome 11 at 82,812,807 bp (GRCm38)
  • C to A, chromosome 13 at 13,696,660 bp (GRCm38)
  • G to A, chromosome 13 at 46,681,662 bp (GRCm38)
  • A to G, chromosome 13 at 67,260,234 bp (GRCm38)
  • A to G, chromosome 14 at 22,598,293 bp (GRCm38)
  • C to T, chromosome 14 at 59,409,432 bp (GRCm38)
  • T to A, chromosome 15 at 76,613,926 bp (GRCm38)
  • A to G, chromosome 16 at 30,273,597 bp (GRCm38)
  • T to A, chromosome 16 at 94,429,608 bp (GRCm38)
  • G to C, chromosome 17 at 17,377,795 bp (GRCm38)
  • T to C, chromosome 17 at 25,751,151 bp (GRCm38)
  • T to C, chromosome 17 at 73,187,884 bp (GRCm38)
  • A to G, chromosome 18 at 20,867,765 bp (GRCm38)
  • G to A, chromosome 19 at 3,375,111 bp (GRCm38)
  • G to T, chromosome 19 at 25,409,580 bp (GRCm38)
  • C to T, chromosome 19 at 38,760,107 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9217 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069053-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.