Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9221Btlr/Mmmh
Stock Number:
069057-MU
Citation ID:
RRID:MMRRC_069057-MU
Other Names:
R9221 (G1)
Major Collection:

Strain Information

Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Uso1
Name: USO1 vesicle docking factor
Synonyms: transcytosis associated protein p115, TAP, Vdp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Tlr9
Name: toll-like receptor 9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81897
Homologene: 68126
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Khdc4
Name: KH domain containing 4, pre-mRNA splicing factor
Synonyms: 2810403A07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74200
Homologene: 41761
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 4,245,043 bp (GRCm38)
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp (GRCm38)
  • T to A, chromosome 1 at 166,497,390 bp (GRCm38)
  • T to A, chromosome 2 at 85,951,841 bp (GRCm38)
  • T to C, chromosome 2 at 88,896,911 bp (GRCm38)
  • T to A, chromosome 2 at 120,269,972 bp (GRCm38)
  • T to A, chromosome 2 at 154,146,132 bp (GRCm38)
  • A to G, chromosome 3 at 54,375,094 bp (GRCm38)
  • AC to A, chromosome 3 at 56,090,972 bp (GRCm38)
  • A to T, chromosome 3 at 64,504,300 bp (GRCm38)
  • A to G, chromosome 3 at 76,661,807 bp (GRCm38)
  • T to C, chromosome 3 at 88,686,546 bp (GRCm38)
  • T to C, chromosome 3 at 95,035,293 bp (GRCm38)
  • A to T, chromosome 3 at 105,680,369 bp (GRCm38)
  • A to G, chromosome 3 at 122,128,179 bp (GRCm38)
  • T to C, chromosome 3 at 135,230,078 bp (GRCm38)
  • A to G, chromosome 4 at 137,560,415 bp (GRCm38)
  • A to T, chromosome 4 at 148,048,169 bp (GRCm38)
  • G to T, chromosome 4 at 152,371,665 bp (GRCm38)
  • A to C, chromosome 5 at 31,169,057 bp (GRCm38)
  • C to A, chromosome 5 at 36,024,566 bp (GRCm38)
  • A to G, chromosome 5 at 92,187,314 bp (GRCm38)
  • A to G, chromosome 5 at 124,265,364 bp (GRCm38)
  • G to A, chromosome 6 at 37,296,680 bp (GRCm38)
  • A to G, chromosome 6 at 77,244,613 bp (GRCm38)
  • C to T, chromosome 6 at 114,695,627 bp (GRCm38)
  • A to G, chromosome 7 at 15,902,925 bp (GRCm38)
  • A to G, chromosome 7 at 100,879,611 bp (GRCm38)
  • G to A, chromosome 7 at 114,415,462 bp (GRCm38)
  • A to T, chromosome 7 at 119,768,908 bp (GRCm38)
  • T to G, chromosome 7 at 130,624,328 bp (GRCm38)
  • C to T, chromosome 7 at 130,624,479 bp (GRCm38)
  • G to T, chromosome 7 at 133,709,520 bp (GRCm38)
  • G to T, chromosome 7 at 143,881,165 bp (GRCm38)
  • A to G, chromosome 8 at 11,441,943 bp (GRCm38)
  • A to T, chromosome 8 at 61,516,557 bp (GRCm38)
  • G to A, chromosome 8 at 111,056,396 bp (GRCm38)
  • G to A, chromosome 8 at 124,673,551 bp (GRCm38)
  • T to C, chromosome 9 at 21,809,857 bp (GRCm38)
  • G to T, chromosome 9 at 97,461,342 bp (GRCm38)
  • A to G, chromosome 9 at 106,224,773 bp (GRCm38)
  • A to G, chromosome 10 at 63,072,050 bp (GRCm38)
  • A to T, chromosome 11 at 58,651,249 bp (GRCm38)
  • A to T, chromosome 11 at 73,171,829 bp (GRCm38)
  • A to T, chromosome 11 at 73,847,282 bp (GRCm38)
  • A to T, chromosome 11 at 80,674,918 bp (GRCm38)
  • A to G, chromosome 11 at 106,989,332 bp (GRCm38)
  • C to A, chromosome 11 at 116,542,838 bp (GRCm38)
  • T to C, chromosome 12 at 3,502,310 bp (GRCm38)
  • T to A, chromosome 12 at 31,463,471 bp (GRCm38)
  • T to C, chromosome 12 at 70,195,627 bp (GRCm38)
  • A to G, chromosome 12 at 102,811,171 bp (GRCm38)
  • A to G, chromosome 13 at 112,689,376 bp (GRCm38)
  • A to T, chromosome 13 at 115,030,159 bp (GRCm38)
  • A to G, chromosome 14 at 37,107,395 bp (GRCm38)
  • G to A, chromosome 15 at 80,150,553 bp (GRCm38)
  • T to C, chromosome 15 at 98,121,307 bp (GRCm38)
  • T to A, chromosome 15 at 101,865,629 bp (GRCm38)
  • A to C, chromosome 16 at 18,786,771 bp (GRCm38)
  • T to C, chromosome 16 at 89,047,767 bp (GRCm38)
  • A to G, chromosome 16 at 97,408,492 bp (GRCm38)
  • T to C, chromosome 17 at 6,256,990 bp (GRCm38)
  • A to T, chromosome 17 at 28,580,159 bp (GRCm38)
  • T to C, chromosome 17 at 31,847,193 bp (GRCm38)
  • A to G, chromosome 17 at 46,919,892 bp (GRCm38)
  • T to A, chromosome 17 at 66,343,884 bp (GRCm38)
  • T to C, chromosome 18 at 43,986,300 bp (GRCm38)
  • A to C, chromosome 18 at 67,634,907 bp (GRCm38)
  • A to G, chromosome 18 at 71,420,362 bp (GRCm38)
  • T to A, chromosome 19 at 9,012,579 bp (GRCm38)
  • A to T, chromosome 19 at 12,321,972 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9221 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069057-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.