Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9241Btlr/Mmmh
Stock Number:
069068-MU
Citation ID:
RRID:MMRRC_069068-MU
Other Names:
R9241 (G1)
Major Collection:

Strain Information

Smarca4
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms: SNF2beta, Brg1, SW1/SNF, b2b692Clo, b2b508.1Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20586
Homologene: 135927
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Mapt
Name: microtubule-associated protein tau
Synonyms: Mtapt, Tau
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17762
HGNC: HGNC:6893
Homologene: 74962
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Ano6
Name: anoctamin 6
Synonyms: 2900059G15Rik, F730003B03Rik, Tmem16f
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105722
VEGA: 15
Homologene: 27888
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 58,252,186 bp (GRCm38)
  • T to G, chromosome 1 at 65,048,859 bp (GRCm38)
  • T to A, chromosome 2 at 25,245,907 bp (GRCm38)
  • T to A, chromosome 2 at 59,913,649 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to C, chromosome 2 at 137,084,587 bp (GRCm38)
  • T to C, chromosome 2 at 160,908,257 bp (GRCm38)
  • C to T, chromosome 2 at 181,718,612 bp (GRCm38)
  • C to T, chromosome 3 at 5,243,637 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • A to G, chromosome 4 at 62,524,608 bp (GRCm38)
  • G to T, chromosome 4 at 101,814,591 bp (GRCm38)
  • T to C, chromosome 4 at 123,378,159 bp (GRCm38)
  • C to T, chromosome 5 at 21,969,069 bp (GRCm38)
  • T to A, chromosome 5 at 113,819,586 bp (GRCm38)
  • C to T, chromosome 5 at 120,553,493 bp (GRCm38)
  • T to C, chromosome 5 at 121,572,157 bp (GRCm38)
  • T to C, chromosome 6 at 140,579,478 bp (GRCm38)
  • A to T, chromosome 7 at 13,269,434 bp (GRCm38)
  • A to G, chromosome 7 at 28,186,633 bp (GRCm38)
  • A to G, chromosome 7 at 45,183,889 bp (GRCm38)
  • T to C, chromosome 7 at 82,635,042 bp (GRCm38)
  • A to G, chromosome 7 at 116,417,880 bp (GRCm38)
  • A to T, chromosome 7 at 135,695,924 bp (GRCm38)
  • G to T, chromosome 8 at 67,963,315 bp (GRCm38)
  • A to G, chromosome 8 at 116,971,198 bp (GRCm38)
  • T to G, chromosome 9 at 21,639,308 bp (GRCm38)
  • A to T, chromosome 9 at 41,974,124 bp (GRCm38)
  • C to A, chromosome 9 at 123,185,236 bp (GRCm38)
  • T to C, chromosome 10 at 82,732,651 bp (GRCm38)
  • A to T, chromosome 11 at 30,865,576 bp (GRCm38)
  • T to C, chromosome 11 at 55,256,740 bp (GRCm38)
  • A to G, chromosome 11 at 57,529,846 bp (GRCm38)
  • A to G, chromosome 11 at 73,260,356 bp (GRCm38)
  • A to T, chromosome 11 at 104,298,971 bp (GRCm38)
  • C to A, chromosome 11 at 117,218,898 bp (GRCm38)
  • G to T, chromosome 13 at 19,094,802 bp (GRCm38)
  • T to C, chromosome 13 at 117,656,713 bp (GRCm38)
  • A to T, chromosome 14 at 101,729,784 bp (GRCm38)
  • G to T, chromosome 14 at 123,572,017 bp (GRCm38)
  • A to G, chromosome 15 at 84,938,410 bp (GRCm38)
  • T to C, chromosome 15 at 85,092,008 bp (GRCm38)
  • T to C, chromosome 15 at 95,791,006 bp (GRCm38)
  • A to C, chromosome 16 at 32,670,098 bp (GRCm38)
  • T to A, chromosome 16 at 91,657,234 bp (GRCm38)
  • A to T, chromosome 17 at 11,237,495 bp (GRCm38)
  • A to T, chromosome 17 at 28,771,213 bp (GRCm38)
  • A to T, chromosome 17 at 33,102,546 bp (GRCm38)
  • A to G, chromosome 17 at 38,274,890 bp (GRCm38)
  • G to T, chromosome 17 at 68,837,166 bp (GRCm38)
  • C to T, chromosome 18 at 36,993,955 bp (GRCm38)
  • T to C, chromosome 19 at 3,389,010 bp (GRCm38)
  • T to C, chromosome 19 at 9,087,929 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9241 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069068-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.