Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9246Btlr/Mmmh
Stock Number:
069072-MU
Citation ID:
RRID:MMRRC_069072-MU
Other Names:
R9246 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Prkcd
Name: protein kinase C, delta
Synonyms: PKCdelta, PKC[d], Pkcd, D14Ertd420e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18753
HGNC: HGNC:9399
Homologene: 55963
Cfl1
Name: cofilin 1, non-muscle
Synonyms: cofilin, Cof, n-cofilin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12631
HGNC: HGNC:1874
Homologene: 99735
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Ctnna1
Name: catenin alpha 1
Synonyms: alpha(E)-catenin, alpha E catenin, Catna1, 2010010M04Rik, catenin (cadherin associated protein), alpha 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12385
VEGA: 18
HGNC: HGNC:2509
Homologene: 1433
Pnn
Name: pinin
Synonyms: D12Ertd512e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18949
VEGA: 12
HGNC: HGNC:9162
Homologene: 37656
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 46,532,774 bp (GRCm38)
  • T to C, chromosome 1 at 75,384,854 bp (GRCm38)
  • G to A, chromosome 1 at 82,453,235 bp (GRCm38)
  • A to G, chromosome 1 at 93,077,779 bp (GRCm38)
  • T to C, chromosome 1 at 119,526,638 bp (GRCm38)
  • G to T, chromosome 1 at 166,398,811 bp (GRCm38)
  • T to C, chromosome 2 at 32,789,574 bp (GRCm38)
  • G to A, chromosome 2 at 74,728,403 bp (GRCm38)
  • A to T, chromosome 2 at 86,314,878 bp (GRCm38)
  • A to G, chromosome 2 at 109,333,474 bp (GRCm38)
  • A to T, chromosome 3 at 88,912,104 bp (GRCm38)
  • A to G, chromosome 4 at 134,837,931 bp (GRCm38)
  • A to T, chromosome 4 at 148,029,409 bp (GRCm38)
  • T to G, chromosome 5 at 24,548,971 bp (GRCm38)
  • G to C, chromosome 5 at 117,879,337 bp (GRCm38)
  • T to A, chromosome 6 at 72,520,611 bp (GRCm38)
  • A to G, chromosome 7 at 5,675,629 bp (GRCm38)
  • C to T, chromosome 7 at 6,008,770 bp (GRCm38)
  • A to T, chromosome 7 at 11,612,393 bp (GRCm38)
  • A to G, chromosome 7 at 16,203,237 bp (GRCm38)
  • T to A, chromosome 7 at 23,660,168 bp (GRCm38)
  • C to T, chromosome 7 at 27,580,536 bp (GRCm38)
  • T to C, chromosome 7 at 46,124,865 bp (GRCm38)
  • A to T, chromosome 7 at 81,041,781 bp (GRCm38)
  • A to G, chromosome 7 at 90,358,176 bp (GRCm38)
  • C to A, chromosome 7 at 102,138,830 bp (GRCm38)
  • C to T, chromosome 7 at 103,346,701 bp (GRCm38)
  • C to T, chromosome 7 at 106,818,731 bp (GRCm38)
  • C to A, chromosome 7 at 141,810,478 bp (GRCm38)
  • T to C, chromosome 8 at 26,072,291 bp (GRCm38)
  • T to C, chromosome 8 at 79,076,503 bp (GRCm38)
  • A to T, chromosome 8 at 87,470,420 bp (GRCm38)
  • A to G, chromosome 8 at 93,950,339 bp (GRCm38)
  • C to T, chromosome 8 at 104,617,970 bp (GRCm38)
  • T to C, chromosome 8 at 105,618,890 bp (GRCm38)
  • G to T, chromosome 8 at 119,730,250 bp (GRCm38)
  • T to C, chromosome 9 at 19,884,390 bp (GRCm38)
  • T to A, chromosome 9 at 100,888,276 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • T to C, chromosome 10 at 5,305,706 bp (GRCm38)
  • G to A, chromosome 10 at 80,002,701 bp (GRCm38)
  • T to A, chromosome 11 at 51,007,064 bp (GRCm38)
  • A to T, chromosome 11 at 102,605,923 bp (GRCm38)
  • T to C, chromosome 12 at 3,899,204 bp (GRCm38)
  • A to G, chromosome 12 at 59,070,143 bp (GRCm38)
  • A to C, chromosome 12 at 84,043,323 bp (GRCm38)
  • C to A, chromosome 14 at 10,421,494 bp (GRCm38)
  • A to G, chromosome 14 at 30,605,475 bp (GRCm38)
  • T to C, chromosome 14 at 34,434,707 bp (GRCm38)
  • T to G, chromosome 14 at 37,079,697 bp (GRCm38)
  • G to A, chromosome 14 at 55,596,241 bp (GRCm38)
  • T to C, chromosome 14 at 56,118,741 bp (GRCm38)
  • T to A, chromosome 14 at 70,571,475 bp (GRCm38)
  • A to G, chromosome 14 at 72,472,874 bp (GRCm38)
  • T to C, chromosome 15 at 78,788,836 bp (GRCm38)
  • T to A, chromosome 16 at 72,972,290 bp (GRCm38)
  • AAAGCCTCCAAAGCCTCCATAGCCAGAGCCATATCCGAAGCCTCCA to AAAGCCTCCA, chromosome 16 at 88,873,971 bp (GRCm38)
  • A to T, chromosome 16 at 96,002,816 bp (GRCm38)
  • G to A, chromosome 17 at 22,605,107 bp (GRCm38)
  • G to A, chromosome 18 at 12,577,902 bp (GRCm38)
  • G to A, chromosome 18 at 16,648,597 bp (GRCm38)
  • A to T, chromosome 18 at 20,860,533 bp (GRCm38)
  • C to A, chromosome 18 at 30,333,311 bp (GRCm38)
  • A to T, chromosome 18 at 34,808,427 bp (GRCm38)
  • T to A, chromosome 18 at 35,223,509 bp (GRCm38)
  • T to A, chromosome 18 at 57,363,136 bp (GRCm38)
  • C to A, chromosome 18 at 62,179,155 bp (GRCm38)
  • G to C, chromosome 19 at 5,493,606 bp (GRCm38)
  • T to C, chromosome 19 at 7,896,844 bp (GRCm38)
  • CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA to CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA, chromosome 19 at 10,948,798 bp (GRCm38)
  • T to C, chromosome 19 at 43,798,443 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9246 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069072-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.