Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9249Btlr/Mmmh
Stock Number:
069074-MU
Citation ID:
RRID:MMRRC_069074-MU
Other Names:
R9249 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 90,779,298 bp (GRCm38)
  • T to C, chromosome 1 at 93,625,084 bp (GRCm38)
  • G to A, chromosome 1 at 156,316,846 bp (GRCm38)
  • A to G, chromosome 1 at 181,135,028 bp (GRCm38)
  • T to C, chromosome 2 at 36,527,547 bp (GRCm38)
  • A to T, chromosome 2 at 87,656,316 bp (GRCm38)
  • T to G, chromosome 2 at 102,831,402 bp (GRCm38)
  • C to T, chromosome 2 at 125,563,984 bp (GRCm38)
  • T to C, chromosome 2 at 164,486,157 bp (GRCm38)
  • T to C, chromosome 2 at 166,891,770 bp (GRCm38)
  • T to C, chromosome 3 at 26,732,881 bp (GRCm38)
  • T to A, chromosome 3 at 37,225,528 bp (GRCm38)
  • T to C, chromosome 3 at 98,806,363 bp (GRCm38)
  • T to C, chromosome 4 at 58,869,427 bp (GRCm38)
  • C to A, chromosome 4 at 111,936,962 bp (GRCm38)
  • C to A, chromosome 4 at 128,419,530 bp (GRCm38)
  • A to T, chromosome 4 at 129,678,675 bp (GRCm38)
  • C to A, chromosome 5 at 24,589,237 bp (GRCm38)
  • C to A, chromosome 5 at 100,385,224 bp (GRCm38)
  • A to G, chromosome 5 at 101,848,493 bp (GRCm38)
  • T to A, chromosome 5 at 113,280,335 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • G to C, chromosome 5 at 117,879,337 bp (GRCm38)
  • T to C, chromosome 5 at 125,109,924 bp (GRCm38)
  • C to A, chromosome 5 at 142,143,795 bp (GRCm38)
  • T to C, chromosome 5 at 145,991,546 bp (GRCm38)
  • A to G, chromosome 6 at 57,002,775 bp (GRCm38)
  • C to T, chromosome 6 at 106,489,761 bp (GRCm38)
  • T to C, chromosome 6 at 118,613,327 bp (GRCm38)
  • T to C, chromosome 7 at 16,157,231 bp (GRCm38)
  • T to A, chromosome 7 at 56,113,142 bp (GRCm38)
  • A to G, chromosome 7 at 83,632,045 bp (GRCm38)
  • T to C, chromosome 7 at 99,458,782 bp (GRCm38)
  • C to A, chromosome 7 at 102,138,830 bp (GRCm38)
  • C to T, chromosome 7 at 109,048,005 bp (GRCm38)
  • A to T, chromosome 8 at 22,653,068 bp (GRCm38)
  • T to A, chromosome 8 at 22,681,719 bp (GRCm38)
  • A to C, chromosome 8 at 63,938,373 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to A, chromosome 8 at 117,019,420 bp (GRCm38)
  • T to C, chromosome 8 at 121,596,094 bp (GRCm38)
  • T to A, chromosome 9 at 39,289,306 bp (GRCm38)
  • A to T, chromosome 9 at 39,510,853 bp (GRCm38)
  • A to G, chromosome 9 at 75,189,997 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • T to C, chromosome 9 at 123,678,876 bp (GRCm38)
  • T to C, chromosome 10 at 76,799,543 bp (GRCm38)
  • T to C, chromosome 10 at 106,913,568 bp (GRCm38)
  • T to A, chromosome 10 at 111,286,151 bp (GRCm38)
  • C to T, chromosome 11 at 67,085,029 bp (GRCm38)
  • T to C, chromosome 11 at 88,294,352 bp (GRCm38)
  • T to A, chromosome 11 at 110,329,339 bp (GRCm38)
  • T to C, chromosome 11 at 120,446,225 bp (GRCm38)
  • T to C, chromosome 11 at 120,813,089 bp (GRCm38)
  • C to T, chromosome 12 at 104,265,469 bp (GRCm38)
  • T to A, chromosome 12 at 105,833,144 bp (GRCm38)
  • T to A, chromosome 13 at 67,257,154 bp (GRCm38)
  • T to C, chromosome 13 at 115,049,298 bp (GRCm38)
  • T to G, chromosome 14 at 56,131,333 bp (GRCm38)
  • A to G, chromosome 15 at 101,016,575 bp (GRCm38)
  • A to T, chromosome 16 at 17,894,860 bp (GRCm38)
  • A to G, chromosome 17 at 28,769,516 bp (GRCm38)
  • C to A, chromosome 17 at 34,614,517 bp (GRCm38)
  • T to C, chromosome 18 at 44,346,198 bp (GRCm38)
  • A to C, chromosome 18 at 61,974,527 bp (GRCm38)
  • A to T, chromosome 19 at 8,843,014 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9249 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069074-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.