Strain Name:
C57BL/6J-MtgxR9258Btlr/Mmmh
Stock Number:
069080-MU
Citation ID:
RRID:MMRRC_069080-MU
Other Names:
R9258 (G1)
Major Collection:

Strain Information

Tnfsf4
Name: tumor necrosis factor (ligand) superfamily, member 4
Synonyms: TXGP1, gp34, Txgp1l, Ath1, CD134L, Ath-1, OX40L
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22164
Homologene: 2495
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: Tarpp, ARPP-21, 0710001E13Rik, R3hdm3, D9Bwg1012e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Ctbp2
Name: C-terminal binding protein 2
Synonyms: Gtrgeo6, D7Ertd45e, Ribeye
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Cadm1
Name: cell adhesion molecule 1
Synonyms: RA175C, Igsf4a, Tslc1, 3100001I08Rik, 2900073G06Rik, Igsf4, RA175N, SgIGSF, RA175B, SynCam, RA175A, Necl2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54725
HGNC: HGNC:5951
Homologene: 8641
Smad7
Name: SMAD family member 7
Synonyms: Madh7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17131
HGNC: HGNC:6773
Homologene: 4314
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Epb41l5
Name: erythrocyte membrane protein band 4.1 like 5
Synonyms: 1700030C16Rik, E230025E14Rik, Lulu1, Epb4.1l5, NBL5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226352
Homologene: 32492
St13
Name: suppression of tumorigenicity 13
Synonyms: 1110007I03Rik, PRO0786, HSPABP1, SNC6, p48, Hsp70 interacting protein, 3110002K08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70356
Homologene: 2921
Gabpa
Name: GA repeat binding protein, alpha
Synonyms: GABPalpha
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14390
HGNC: HGNC:4071
Homologene: 1543
Pcsk9
Name: proprotein convertase subtilisin/kexin type 9
Synonyms: Narc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100102
Homologene: 17790
Unc13d
Name: unc-13 homolog D
Synonyms: Jinx, 2610108D09Rik, Munc13-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Gas2l3
Name: growth arrest-specific 2 like 3
Synonyms: LOC237436, 8430435B07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237436
VEGA: 10
Homologene: 18386
Sh3gl1
Name: SH3-domain GRB2-like 1
Synonyms: Sh3d2b, SH3P8, EEN, endophilin A2, endophilin II
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20405
VEGA: 17
Homologene: 55709
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212377
Homologene: 18874
Tbr1
Name: T-box brain transcription factor 1
Synonyms: T-box brain gene 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21375
Homologene: 4807
Rasal1
Name: RAS protein activator like 1 (GAP1 like)
Synonyms: MRASAL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19415
HGNC: HGNC:9873
Homologene: 3423
Scube2
Name: signal peptide, CUB domain, EGF-like 2
Synonyms: ICRFP703N2430Q5.1, ICRFP703B1614Q5.1, Cegf1, 4932442O19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56788
Homologene: 36383
Nmb
Name: neuromedin B
Synonyms: 3110023K12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68039
HGNC: HGNC:7842
Homologene: 36392
Snx29
Name: sorting nexin 29
Synonyms: Gm11170, LOC381035, Rundc2a, LOC385605, 4933437K13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Sppl3
Name: signal peptide peptidase 3
Synonyms: 4833416I09Rik, Usmg3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74585
Homologene: 15563
Adam18
Name: a disintegrin and metallopeptidase domain 18
Synonyms: Dtgn3, Adam27
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13524
HGNC: HGNC:196
Homologene: 74941
H13
Name: histocompatibility 13
Synonyms: 5031424B04Rik, H-13, 4930443L17Rik, 1200006O09Rik, Hm13, Spp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14950
Homologene: 7749
Gpn3
Name: GPN-loop GTPase 3
Synonyms: Atpbd1c, A930018B01Rik, D5Ertd708e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68080
Homologene: 6487
Ola1
Name: Obg-like ATPase 1
Synonyms: 2810405J23Rik, 2810409H07Rik, Gtpbp9, 2510025G09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67059
Homologene: 5361
Eme2
Name: essential meiotic structure-specific endonuclease subunit 2
Synonyms: 2810013J18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193838
Homologene: 19180
Rrbp1
Name: ribosome binding protein 1
Synonyms: p180, mRRp0, mRRp47, 5730465C04Rik, ES/130, mRRp5.4, mRRp2, mRRp10, mRRp41, mRRp16.8, mRRp15a, 1700087N07Rik, mRRp1.8, mRRp15b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 81910
Homologene: 68138
Cep152
Name: centrosomal protein 152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99100
Homologene: 37159
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Cdh6
Name: cadherin 6
Synonyms: K-cadherin, cad6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12563
VEGA: 15
HGNC: HGNC:1765
Homologene: 21027
Dnajc6
Name: DnaJ heat shock protein family (Hsp40) member C6
Synonyms: auxilin, 2810027M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72685
Homologene: 8865
Smad6
Name: SMAD family member 6
Synonyms: Madh6, Smad 6, b2b390Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17130
HGNC: HGNC:6772
Homologene: 4079
Rpgrip1l
Name: Rpgrip1-like
Synonyms: fantom, Ftm, Nphp8, 1700047E16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: 2900022L05Rik, Dnhd3, Dnahc2, D330014H01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Stk32a
Name: serine/threonine kinase 32A
Synonyms: A930015B13Rik, YANK1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269019
VEGA: 18
Homologene: 65357
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, steerin 3, unc53H3, 9630020C08Rik, 4732483H20Rik, POMFIL1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Sec14l1
Name: SEC14-like lipid binding 1
Synonyms: 2810012L19Rik, 1200017E04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74136
Homologene: 37719
Wdr17
Name: WD repeat domain 17
Synonyms: 3010002I12Rik, B230207L18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244484
Homologene: 12460
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: 4732499L03Rik, melastatin, Mlsn1, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Slc45a1
Name: solute carrier family 45, member 1
Synonyms: Dnb5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242773
Homologene: 44908
Ogfod2
Name: 2-oxoglutarate and iron-dependent oxygenase domain containing 2
Synonyms: 1300006G11Rik, 5730405M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66627
Homologene: 32588
Eogt
Name: EGF domain specific O-linked N-acetylglucosamine transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101351
Homologene: 65276
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Lmntd1
Name: lamin tail domain containing 1
Synonyms: Lmna-rs1, Ifltd1, 4933403M22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74071
Homologene: 69453
Arnt2
Name: aryl hydrocarbon receptor nuclear translocator 2
Synonyms: bHLHe1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11864
Homologene: 7230
Des
Name: desmin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13346
HGNC: HGNC:2770
Homologene: 56469
Aox2
Name: aldehyde oxidase 2
Synonyms: Aox3l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213043
Homologene: 84622
Arvcf
Name: armadillo repeat gene deleted in velocardiofacial syndrome
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11877
HGNC: HGNC:728
Homologene: 31046
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546983
Homologene: 115466
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Kmt2b
Name: lysine (K)-specific methyltransferase 2B
Synonyms: Wbp7, 2610014H22Rik, Mll2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75410
Homologene: 22838
Tmc5
Name: transmembrane channel-like gene family 5
Synonyms: 4932443L08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74424
Homologene: 11713
Ildr2
Name: immunoglobulin-like domain containing receptor 2
Synonyms: 2810478N18Rik, 3110063L10Rik, ENSMUSG00000040612, OTTMUSG00000021748, Dbsm1, D1Ertd471e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039795
Homologene: 52388
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, BIG3, D10Bwg1379e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Nccrp1
Name: non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Synonyms: 1190020J12Rik, LOC233038
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233038
Homologene: 19257
Or1e30
Name: olfactory receptor family 1 subfamily E member 30
Synonyms: MOR135-26, GA_x6K02T2P1NL-3938806-3939741, Olfr390
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258344
Homologene: 115483
Cpeb2
Name: cytoplasmic polyadenylation element binding protein 2
Synonyms: A630055H10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231207
Homologene: 17995
Fmo5
Name: flavin containing monooxygenase 5
Synonyms: 5033418D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14263
HGNC: HGNC:3773
Homologene: 68185
Abtb2
Name: ankyrin repeat and BTB domain containing 2
Synonyms: BPOZ-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99382
Homologene: 15904
Prl2c5
Name: prolactin family 2, subfamily c, member 5
Synonyms: PLF-4, Mrpplf4, MRP-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107849
Homologene: 40763
Or9i14
Name: olfactory receptor family 9 subfamily I member 14
Synonyms: GA_x6K02T2RE5P-4147744-4146800, Olfr1499, MOR211-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258792
Homologene: 17393
Or5p68
Name: olfactory receptor family 5 subfamily P member 68
Synonyms: MOR204-35, Olfr493, GA_x6K02T2PBJ9-10676998-10676054
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258307
Homologene: 17188
Shank3
Name: SH3 and multiple ankyrin repeat domains 3
Synonyms: ProSAP2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 58234
Homologene: 75163
Trmt10c
Name: tRNA methyltransferase 10C, mitochondrial RNase P subunit
Synonyms: Rg9mtd1, D16Ertd454e, 1300018J16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52575
Homologene: 9858
Or4k47
Name: olfactory receptor family 4 subfamily K member 47
Synonyms: Olfr1297, MOR248-4, GA_x6K02T2Q125-72673494-72672556
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258890
Homologene: 115545
Slc25a24
Name: solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 24
Synonyms: 2610016M12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229731
Homologene: 92693
Abcb10
Name: ATP-binding cassette, sub-family B member 10
Synonyms: ABC-me
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56199
HGNC: HGNC:41
Homologene: 6474
Matcap1
Name: microtubule associated tyrosine carboxypeptidase 1
Synonyms: MATCAP, 4931428F04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74356
Homologene: 47588
St3gal4
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Synonyms: ST3Gal IV, Siat4c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20443
VEGA: 9
Homologene: 4572
Vmn1r74
Name: vomeronasal 1 receptor 74
Synonyms: V1rg5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171240
Homologene: 110796
Ehd3
Name: EH-domain containing 3
Synonyms: Ehd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57440
HGNC: HGNC:3244
Homologene: 81837
Ifih1
Name: interferon induced with helicase C domain 1
Synonyms: Helicard, 9130009C22Rik, MDA-5, MDA5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71586
Homologene: 32535
Vmn1r199
Name: vomeronasal 1 receptor 199
Synonyms: V1rh4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171247
Homologene: 110880
Tas2r138
Name: taste receptor, type 2, member 138
Synonyms: T2R138, mt2r31, Tas2r38
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387513
HGNC: HGNC:9584
Homologene: 47976
Ankrd54
Name: ankyrin repeat domain 54
Synonyms: C730048E16Rik, Liar
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223690
Homologene: 16352
Prl3d3
Name: prolactin family 3, subfamily d, member 3
Synonyms: PL-Ig, Plig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 215029
Homologene: 137215
Gm5592
Name: predicted gene 5592
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434172
Homologene: 45597
Lrrc32
Name: leucine rich repeat containing 32
Synonyms: D7H11S833E, Garp, D11S833Eh, EG434215
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434215
HGNC: HGNC:4161
Homologene: 4027
Stoml3
Name: stomatin (Epb7.2)-like 3
Synonyms: SRO, SLP3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229277
Homologene: 16628
Dusp13b
Name: dual specificity phosphatase 13B
Synonyms: LOC382853, LMW-DSP6, Dusp13, TMDP, TS-DSP6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27389
Homologene: 121602
Tbc1d12
Name: TBC1D12: TBC1 domain family, member 12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 209478
VEGA: 19
Homologene: 50835
H2-Q4
Name: histocompatibility 2, Q region locus 4
Synonyms: Qa4, Qa-4, Qb1, Qb-1, Qat-4, H-2Q4, H2-Gs10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15015
Homologene: 128352
Slc25a41
Name: solute carrier family 25, member 41
Synonyms: 4933406J04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 103775
Homologene: 27855
Rpl3l
Name: ribosomal protein L3-like
Synonyms: 1110057H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66211
Homologene: 68434
Prrt1
Name: proline-rich transmembrane protein 1
Synonyms: NG5, SynDIG4, G5b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 260297
Homologene: 134500
Or52e2
Name: olfactory receptor family 52 subfamily E member 2
Synonyms: GA_x6K02T2PBJ9-5871256-5870303, MOR32-3, Olfr589
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259054
Homologene: 133046
Trav5-1
Name: T cell receptor alpha variable 5-1
Synonyms: Gm7124, Trav5-1 T-cell receptor alpha chain V region 5-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 633740
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Taf7
Name: TATA-box binding protein associated factor 7
Synonyms: Taf2f, TAFII55, 55kDa
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 24074
Homologene: 133942
Or51v15-ps1
Name: olfactory receptor family 51 subfamily V member 15, pseudogene 1
Synonyms: MOR4-4_p, MOR4-3P, GA_x6K02T2PBJ9-6352653-6351709, Olfr621-ps1, EG667639
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667639
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 20,373,950 bp (GRCm38)
  • A to T, chromosome 1 at 58,312,356 bp (GRCm38)
  • G to T, chromosome 1 at 75,363,645 bp (GRCm38)
  • T to C, chromosome 1 at 90,772,981 bp (GRCm38)
  • T to C, chromosome 1 at 119,578,971 bp (GRCm38)
  • A to C, chromosome 1 at 161,417,243 bp (GRCm38)
  • A to G, chromosome 1 at 166,303,589 bp (GRCm38)
  • A to T, chromosome 2 at 22,577,533 bp (GRCm38)
  • T to A, chromosome 2 at 61,812,379 bp (GRCm38)
  • A to G, chromosome 2 at 62,611,898 bp (GRCm38)
  • A to T, chromosome 2 at 73,099,388 bp (GRCm38)
  • A to C, chromosome 2 at 103,716,065 bp (GRCm38)
  • A to T, chromosome 2 at 111,621,984 bp (GRCm38)
  • A to G, chromosome 2 at 112,653,019 bp (GRCm38)
  • G to A, chromosome 2 at 125,579,436 bp (GRCm38)
  • C to A, chromosome 2 at 144,011,241 bp (GRCm38)
  • T to C, chromosome 2 at 152,681,079 bp (GRCm38)
  • T to A, chromosome 3 at 53,497,976 bp (GRCm38)
  • G to T, chromosome 3 at 97,651,486 bp (GRCm38)
  • A to G, chromosome 3 at 109,159,435 bp (GRCm38)
  • A to T, chromosome 4 at 24,588,238 bp (GRCm38)
  • T to C, chromosome 4 at 101,618,616 bp (GRCm38)
  • T to C, chromosome 4 at 106,458,850 bp (GRCm38)
  • A to T, chromosome 4 at 150,638,614 bp (GRCm38)
  • T to A, chromosome 5 at 43,234,112 bp (GRCm38)
  • G to A, chromosome 5 at 115,095,863 bp (GRCm38)
  • A to T, chromosome 5 at 120,655,090 bp (GRCm38)
  • A to T, chromosome 5 at 122,381,445 bp (GRCm38)
  • T to A, chromosome 5 at 124,112,442 bp (GRCm38)
  • A to G, chromosome 6 at 40,613,195 bp (GRCm38)
  • A to G, chromosome 6 at 40,680,187 bp (GRCm38)
  • T to A, chromosome 6 at 97,112,082 bp (GRCm38)
  • T to C, chromosome 6 at 145,413,530 bp (GRCm38)
  • G to T, chromosome 7 at 10,710,160 bp (GRCm38)
  • T to A, chromosome 7 at 11,847,072 bp (GRCm38)
  • C to T, chromosome 7 at 28,546,207 bp (GRCm38)
  • A to T, chromosome 7 at 30,582,468 bp (GRCm38)
  • C to T, chromosome 7 at 41,288,983 bp (GRCm38)
  • T to C, chromosome 7 at 64,234,965 bp (GRCm38)
  • T to C, chromosome 7 at 80,904,253 bp (GRCm38)
  • C to T, chromosome 7 at 84,361,590 bp (GRCm38)
  • T to A, chromosome 7 at 86,803,094 bp (GRCm38)
  • T to A, chromosome 7 at 98,499,138 bp (GRCm38)
  • A to G, chromosome 7 at 100,448,819 bp (GRCm38)
  • C to A, chromosome 7 at 103,155,202 bp (GRCm38)
  • T to G, chromosome 7 at 103,629,336 bp (GRCm38)
  • T to G, chromosome 7 at 108,346,679 bp (GRCm38)
  • G to T, chromosome 7 at 109,799,308 bp (GRCm38)
  • A to T, chromosome 7 at 118,623,278 bp (GRCm38)
  • A to T, chromosome 7 at 132,995,292 bp (GRCm38)
  • G to A, chromosome 8 at 24,668,558 bp (GRCm38)
  • G to A, chromosome 8 at 54,659,619 bp (GRCm38)
  • A to T, chromosome 8 at 91,260,986 bp (GRCm38)
  • A to G, chromosome 8 at 105,282,143 bp (GRCm38)
  • T to A, chromosome 8 at 123,982,608 bp (GRCm38)
  • A to G, chromosome 9 at 35,052,347 bp (GRCm38)
  • A to G, chromosome 9 at 47,799,432 bp (GRCm38)
  • A to T, chromosome 9 at 64,020,291 bp (GRCm38)
  • T to C, chromosome 9 at 79,706,363 bp (GRCm38)
  • G to A, chromosome 9 at 112,124,888 bp (GRCm38)
  • C to T, chromosome 10 at 18,589,639 bp (GRCm38)
  • G to T, chromosome 10 at 89,426,453 bp (GRCm38)
  • A to C, chromosome 10 at 92,935,098 bp (GRCm38)
  • T to A, chromosome 10 at 109,714,382 bp (GRCm38)
  • G to T, chromosome 11 at 69,477,253 bp (GRCm38)
  • T to G, chromosome 11 at 73,787,455 bp (GRCm38)
  • A to C, chromosome 11 at 103,502,196 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • CATGCC to CATGCCTCCGATGCC, chromosome 11 at 116,068,181 bp (GRCm38)
  • T to C, chromosome 11 at 117,150,176 bp (GRCm38)
  • A to G, chromosome 12 at 98,844,117 bp (GRCm38)
  • A to T, chromosome 13 at 13,190,712 bp (GRCm38)
  • A to G, chromosome 13 at 22,382,652 bp (GRCm38)
  • A to T, chromosome 13 at 27,160,948 bp (GRCm38)
  • T to C, chromosome 14 at 21,741,087 bp (GRCm38)
  • T to G, chromosome 14 at 52,622,890 bp (GRCm38)
  • A to G, chromosome 15 at 13,064,376 bp (GRCm38)
  • A to T, chromosome 15 at 79,062,796 bp (GRCm38)
  • T to G, chromosome 15 at 81,388,368 bp (GRCm38)
  • A to T, chromosome 15 at 89,504,318 bp (GRCm38)
  • G to T, chromosome 16 at 11,714,935 bp (GRCm38)
  • A to G, chromosome 16 at 18,398,207 bp (GRCm38)
  • A to T, chromosome 16 at 56,034,283 bp (GRCm38)
  • C to T, chromosome 16 at 84,856,515 bp (GRCm38)
  • A to T, chromosome 16 at 91,677,682 bp (GRCm38)
  • T to G, chromosome 17 at 24,732,473 bp (GRCm38)
  • C to T, chromosome 17 at 24,893,079 bp (GRCm38)
  • T to C, chromosome 17 at 28,058,426 bp (GRCm38)
  • A to G, chromosome 17 at 34,631,146 bp (GRCm38)
  • T to A, chromosome 17 at 35,380,129 bp (GRCm38)
  • T to A, chromosome 17 at 56,018,911 bp (GRCm38)
  • A to T, chromosome 17 at 57,041,580 bp (GRCm38)
  • A to G, chromosome 17 at 73,820,566 bp (GRCm38)
  • T to C, chromosome 18 at 37,642,968 bp (GRCm38)
  • T to A, chromosome 18 at 43,311,934 bp (GRCm38)
  • C to A, chromosome 18 at 75,394,246 bp (GRCm38)
  • A to T, chromosome 19 at 13,814,735 bp (GRCm38)
  • A to G, chromosome 19 at 38,901,379 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9258 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069080-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.