Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9258Btlr/Mmmh
Stock Number:
069080-MU
Citation ID:
RRID:MMRRC_069080-MU
Other Names:
R9258 (G1)
Major Collection:

Strain Information

Tnfsf4
Name: tumor necrosis factor (ligand) superfamily, member 4
Synonyms: OX40L, gp34, Txgp1l, Ath-1, TXGP1, CD134L, Ath1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22164
Homologene: 2495
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Cadm1
Name: cell adhesion molecule 1
Synonyms: 3100001I08Rik, 2900073G06Rik, RA175N, RA175C, RA175B, RA175A, Necl2, SgIGSF, Tslc1, SynCam, Igsf4, Igsf4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54725
HGNC: HGNC:5951
Homologene: 8641
Smad7
Name: SMAD family member 7
Synonyms: Madh7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17131
HGNC: HGNC:6773
Homologene: 4314
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Epb41l5
Name: erythrocyte membrane protein band 4.1 like 5
Synonyms: NBL5, 1700030C16Rik, E230025E14Rik, Lulu1, Epb4.1l5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226352
Homologene: 32492
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 20,373,950 bp (GRCm38)
  • A to T, chromosome 1 at 58,312,356 bp (GRCm38)
  • G to T, chromosome 1 at 75,363,645 bp (GRCm38)
  • T to C, chromosome 1 at 90,772,981 bp (GRCm38)
  • T to C, chromosome 1 at 119,578,971 bp (GRCm38)
  • A to C, chromosome 1 at 161,417,243 bp (GRCm38)
  • A to G, chromosome 1 at 166,303,589 bp (GRCm38)
  • A to T, chromosome 2 at 22,577,533 bp (GRCm38)
  • T to A, chromosome 2 at 61,812,379 bp (GRCm38)
  • A to G, chromosome 2 at 62,611,898 bp (GRCm38)
  • A to T, chromosome 2 at 73,099,388 bp (GRCm38)
  • A to C, chromosome 2 at 103,716,065 bp (GRCm38)
  • A to T, chromosome 2 at 111,621,984 bp (GRCm38)
  • A to G, chromosome 2 at 112,653,019 bp (GRCm38)
  • G to A, chromosome 2 at 125,579,436 bp (GRCm38)
  • C to A, chromosome 2 at 144,011,241 bp (GRCm38)
  • T to C, chromosome 2 at 152,681,079 bp (GRCm38)
  • T to A, chromosome 3 at 53,497,976 bp (GRCm38)
  • G to T, chromosome 3 at 97,651,486 bp (GRCm38)
  • A to G, chromosome 3 at 109,159,435 bp (GRCm38)
  • A to T, chromosome 4 at 24,588,238 bp (GRCm38)
  • T to C, chromosome 4 at 101,618,616 bp (GRCm38)
  • T to C, chromosome 4 at 106,458,850 bp (GRCm38)
  • A to T, chromosome 4 at 150,638,614 bp (GRCm38)
  • T to A, chromosome 5 at 43,234,112 bp (GRCm38)
  • G to A, chromosome 5 at 115,095,863 bp (GRCm38)
  • A to T, chromosome 5 at 120,655,090 bp (GRCm38)
  • A to T, chromosome 5 at 122,381,445 bp (GRCm38)
  • T to A, chromosome 5 at 124,112,442 bp (GRCm38)
  • A to G, chromosome 6 at 40,613,195 bp (GRCm38)
  • A to G, chromosome 6 at 40,680,187 bp (GRCm38)
  • T to A, chromosome 6 at 97,112,082 bp (GRCm38)
  • T to C, chromosome 6 at 145,413,530 bp (GRCm38)
  • G to T, chromosome 7 at 10,710,160 bp (GRCm38)
  • T to A, chromosome 7 at 11,847,072 bp (GRCm38)
  • C to T, chromosome 7 at 28,546,207 bp (GRCm38)
  • A to T, chromosome 7 at 30,582,468 bp (GRCm38)
  • C to T, chromosome 7 at 41,288,983 bp (GRCm38)
  • T to C, chromosome 7 at 64,234,965 bp (GRCm38)
  • T to C, chromosome 7 at 80,904,253 bp (GRCm38)
  • C to T, chromosome 7 at 84,361,590 bp (GRCm38)
  • T to A, chromosome 7 at 86,803,094 bp (GRCm38)
  • T to A, chromosome 7 at 98,499,138 bp (GRCm38)
  • A to G, chromosome 7 at 100,448,819 bp (GRCm38)
  • C to A, chromosome 7 at 103,155,202 bp (GRCm38)
  • T to G, chromosome 7 at 103,629,336 bp (GRCm38)
  • T to G, chromosome 7 at 108,346,679 bp (GRCm38)
  • G to T, chromosome 7 at 109,799,308 bp (GRCm38)
  • A to T, chromosome 7 at 118,623,278 bp (GRCm38)
  • A to T, chromosome 7 at 132,995,292 bp (GRCm38)
  • G to A, chromosome 8 at 24,668,558 bp (GRCm38)
  • G to A, chromosome 8 at 54,659,619 bp (GRCm38)
  • A to T, chromosome 8 at 91,260,986 bp (GRCm38)
  • A to G, chromosome 8 at 105,282,143 bp (GRCm38)
  • T to A, chromosome 8 at 123,982,608 bp (GRCm38)
  • A to G, chromosome 9 at 35,052,347 bp (GRCm38)
  • A to G, chromosome 9 at 47,799,432 bp (GRCm38)
  • A to T, chromosome 9 at 64,020,291 bp (GRCm38)
  • T to C, chromosome 9 at 79,706,363 bp (GRCm38)
  • G to A, chromosome 9 at 112,124,888 bp (GRCm38)
  • C to T, chromosome 10 at 18,589,639 bp (GRCm38)
  • G to T, chromosome 10 at 89,426,453 bp (GRCm38)
  • A to C, chromosome 10 at 92,935,098 bp (GRCm38)
  • T to A, chromosome 10 at 109,714,382 bp (GRCm38)
  • G to T, chromosome 11 at 69,477,253 bp (GRCm38)
  • T to G, chromosome 11 at 73,787,455 bp (GRCm38)
  • A to C, chromosome 11 at 103,502,196 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • CATGCC to CATGCCTCCGATGCC, chromosome 11 at 116,068,181 bp (GRCm38)
  • T to C, chromosome 11 at 117,150,176 bp (GRCm38)
  • A to G, chromosome 12 at 98,844,117 bp (GRCm38)
  • A to T, chromosome 13 at 13,190,712 bp (GRCm38)
  • A to G, chromosome 13 at 22,382,652 bp (GRCm38)
  • A to T, chromosome 13 at 27,160,948 bp (GRCm38)
  • T to C, chromosome 14 at 21,741,087 bp (GRCm38)
  • T to G, chromosome 14 at 52,622,890 bp (GRCm38)
  • A to G, chromosome 15 at 13,064,376 bp (GRCm38)
  • A to T, chromosome 15 at 79,062,796 bp (GRCm38)
  • T to G, chromosome 15 at 81,388,368 bp (GRCm38)
  • A to T, chromosome 15 at 89,504,318 bp (GRCm38)
  • G to T, chromosome 16 at 11,714,935 bp (GRCm38)
  • A to G, chromosome 16 at 18,398,207 bp (GRCm38)
  • A to T, chromosome 16 at 56,034,283 bp (GRCm38)
  • C to T, chromosome 16 at 84,856,515 bp (GRCm38)
  • A to T, chromosome 16 at 91,677,682 bp (GRCm38)
  • T to G, chromosome 17 at 24,732,473 bp (GRCm38)
  • C to T, chromosome 17 at 24,893,079 bp (GRCm38)
  • T to C, chromosome 17 at 28,058,426 bp (GRCm38)
  • A to G, chromosome 17 at 34,631,146 bp (GRCm38)
  • T to A, chromosome 17 at 35,380,129 bp (GRCm38)
  • T to A, chromosome 17 at 56,018,911 bp (GRCm38)
  • A to T, chromosome 17 at 57,041,580 bp (GRCm38)
  • A to G, chromosome 17 at 73,820,566 bp (GRCm38)
  • T to C, chromosome 18 at 37,642,968 bp (GRCm38)
  • T to A, chromosome 18 at 43,311,934 bp (GRCm38)
  • C to A, chromosome 18 at 75,394,246 bp (GRCm38)
  • A to T, chromosome 19 at 13,814,735 bp (GRCm38)
  • A to G, chromosome 19 at 38,901,379 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9258 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069080-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.