Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9284Btlr/Mmmh
Stock Number:
069103-MU
Citation ID:
RRID:MMRRC_069103-MU
Other Names:
R9284 (G1)
Major Collection:

Strain Information

Sparcl1
Name: SPARC-like 1
Synonyms: Sc1, hevin, mast9, Ecm2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13602
Homologene: 3438
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Ccdc12
Name: coiled-coil domain containing 12
Synonyms: 2700094L05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72654
Homologene: 41751
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Rbpj
Name: recombination signal binding protein for immunoglobulin kappa J region
Synonyms: CBF1, Igkrsbp, RBP-J kappa, RBPjk, Igkjrb, Rbpsuh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19664
HGNC: HGNC:5724
Homologene: 7511
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP-2, nuc, SREBP2, SREBP2gc, bHLHd2, lop13
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Gpatch2l
Name: G patch domain containing 2 like
Synonyms: 1700020O03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70373
VEGA: 12
Homologene: 9942
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Map3k20
Name: mitogen-activated protein kinase kinase kinase 20
Synonyms: MLTKbeta, MLTKalpha, B230120H23Rik, Zak
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65964
Homologene: 32331
Scfd1
Name: Sec1 family domain containing 1
Synonyms: STXBP1L2, RA410, 3110021P21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76983
VEGA: 12
Homologene: 5650
Iws1
Name: IWS1, SUPT6 interacting protein
Synonyms: 1700069O15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73473
Homologene: 134421
Cntnap1
Name: contactin associated protein-like 1
Synonyms: p190, Caspr, Nrxn4, NCP1, paranodin, shm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53321
HGNC: HGNC:8011
Homologene: 2693
Gp5
Name: glycoprotein 5 platelet
Synonyms: GPV, GP V
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14729
VEGA: 16
HGNC: HGNC:4443
Homologene: 74523
Angptl3
Name: angiopoietin-like 3
Synonyms: hypl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30924
HGNC: HGNC:491
Homologene: 8499
Nr6a1
Name: nuclear receptor subfamily 6, group A, member 1
Synonyms: Gcnf, NCNF, 1700113M01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14536
HGNC: HGNC:7985
Homologene: 36308
Zfp266
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77519
Homologene: 105676
Nup160
Name: nucleoporin 160
Synonyms: 2810011M03Rik, Gtl1-13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59015
Homologene: 32509
Cep95
Name: centrosomal protein 95
Synonyms: F630025I20Rik, 4732496G21Rik, Ccdc45
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320162
Homologene: 16297
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Pla2g4e
Name: phospholipase A2, group IVE
Synonyms: 2310026J01Rik, Pla2epsilon
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329502
Homologene: 65339
Tnik
Name: TRAF2 and NCK interacting kinase
Synonyms: 4831440I19Rik, 1500031A17Rik, C530008O15Rik, C630040K21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 665113
Homologene: 77943
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Atmin
Name: ATM interactor
Synonyms: Asciz, gpg6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234776
Homologene: 35321
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Ptpdc1
Name: protein tyrosine phosphatase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218232
VEGA: 13
Homologene: 17576
Fbxw26
Name: F-box and WD-40 domain protein 26
Synonyms: Gm5163
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382109
Homologene: 110776
Catsperg2
Name: cation channel sperm associated auxiliary subunit gamma 2
Synonyms: 1700067C01Rik, CATSPERG
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76718
Homologene: 10915
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: t2md1, LLGL4, A830015P08Rik, insulin level locus 1, tomosyn-2, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Or2aj4
Name: olfactory receptor family 2 subfamily AJ member 4
Synonyms: GA_x54KRFPKG5P-16014972-16014031, MOR273-3P, Olfr169
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258158
Homologene: 128058
Stard7
Name: StAR related lipid transfer domain containing 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99138
Homologene: 32463
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Ppfia3
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: 2410127E16Rik, Liprin-alpha3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76787
HGNC: HGNC:9247
Homologene: 37833
Or5d37
Name: olfactory receptor family 5 subfamily D member 37
Synonyms: GA_x6K02T2Q125-49585842-49584862, MOR174-11, Olfr1164
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258634
Homologene: 74077
Or2ag1b
Name: olfactory receptor family 2 subfamily AG member 1B
Synonyms: GA_x6K02T2PBJ9-9067220-9066273, MOR283-9, Olfr694
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258444
Homologene: 79345
Phyhd1
Name: phytanoyl-CoA dioxygenase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227696
Homologene: 14939
Gm4841
Name: predicted gene 4841
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225594
VEGA: 18
Isg20l2
Name: interferon stimulated exonuclease gene 20-like 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229504
Homologene: 12814
Cyp3a16
Name: cytochrome P450, family 3, subfamily a, polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13114
HGNC: HGNC:2638
Homologene: 133568
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208151
Homologene: 28135
Tlr5
Name: toll-like receptor 5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53791
Homologene: 20698
Sp110
Name: Sp110 nuclear body protein
Synonyms: 52kDa, Ipr1, 5830484A20Rik, 5031415C07Rik, Ifi75
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109032
HGNC: HGNC:5401
Homologene: 82192
Aadacl4fm5
Name: AADACL4 family member 5
Synonyms: LOC329993, Gm438
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329993
Homologene: 135765
Adamtsl2
Name: ADAMTS-like 2
Synonyms: A930008K15Rik, stb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77794
Homologene: 8798
Mr1
Name: major histocompatibility complex, class I-related
Synonyms: MR1, H2ls
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15064
HGNC: HGNC:4975
Homologene: 123981
Nom1
Name: nucleolar protein with MIF4G domain 1
Synonyms: LOC381627, D5Kng1, Gm1040
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433864
Homologene: 39776
Or4d10b
Name: olfactory receptor family 4 subfamily D member 10B
Synonyms: GA_x6K02T2RE5P-2418550-2417609, MOR239-2, Olfr1424
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258676
Homologene: 82294
Cacng8
Name: calcium channel, voltage-dependent, gamma subunit 8
Synonyms: TARP gamma 8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81905
Homologene: 12894
Erich3
Name: glutamate rich 3
Synonyms: 5031409G23Rik, 4922501L14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 209601
Homologene: 27877
Tssk5
Name: testis-specific serine kinase 5
Synonyms: 1700091F14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73542
VEGA: 15
Homologene: 18832
Zc2hc1b
Name: zinc finger, C2HC-type containing 1B
Synonyms: 4930519B02Rik, Fam164b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75122
VEGA: 10
Homologene: 77965
Nme9
Name: NME/NM23 family member 9
Synonyms: Txndc6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 623534
Homologene: 52255
Or6c200-ps1
Name: olfactory receptor family 6 subfamily C member 200, pseudogene 1
Synonyms: GA_x6K02T00F4V-833-1750, GA_x6K02T2PULF-10720146-10719487, MOR115-6_p, Gm6349, Olfr227, Olfr764, Olfr764-ps1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 622733
Homologene: 67771
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 85,579,642 bp (GRCm38)
  • T to A, chromosome 1 at 155,137,528 bp (GRCm38)
  • T to C, chromosome 1 at 182,973,812 bp (GRCm38)
  • G to A, chromosome 2 at 27,104,043 bp (GRCm38)
  • G to T, chromosome 2 at 30,266,867 bp (GRCm38)
  • A to T, chromosome 2 at 38,748,878 bp (GRCm38)
  • T to C, chromosome 2 at 52,108,552 bp (GRCm38)
  • C to T, chromosome 2 at 72,398,411 bp (GRCm38)
  • T to A, chromosome 2 at 88,093,934 bp (GRCm38)
  • T to C, chromosome 2 at 90,718,031 bp (GRCm38)
  • T to C, chromosome 2 at 120,174,249 bp (GRCm38)
  • T to G, chromosome 2 at 127,291,036 bp (GRCm38)
  • G to T, chromosome 3 at 28,539,421 bp (GRCm38)
  • A to T, chromosome 3 at 79,092,703 bp (GRCm38)
  • T to A, chromosome 3 at 87,931,684 bp (GRCm38)
  • A to T, chromosome 3 at 154,698,671 bp (GRCm38)
  • A to G, chromosome 4 at 99,031,243 bp (GRCm38)
  • T to C, chromosome 4 at 143,397,199 bp (GRCm38)
  • T to G, chromosome 4 at 144,777,621 bp (GRCm38)
  • T to A, chromosome 4 at 148,459,080 bp (GRCm38)
  • T to A, chromosome 5 at 29,442,534 bp (GRCm38)
  • T to G, chromosome 5 at 53,653,382 bp (GRCm38)
  • T to A, chromosome 5 at 81,509,721 bp (GRCm38)
  • A to G, chromosome 5 at 87,008,281 bp (GRCm38)
  • A to T, chromosome 5 at 104,088,479 bp (GRCm38)
  • T to C, chromosome 5 at 125,787,647 bp (GRCm38)
  • T to A, chromosome 5 at 145,440,494 bp (GRCm38)
  • A to T, chromosome 6 at 146,354,676 bp (GRCm38)
  • C to A, chromosome 7 at 3,411,230 bp (GRCm38)
  • A to G, chromosome 7 at 29,705,581 bp (GRCm38)
  • A to G, chromosome 7 at 45,361,798 bp (GRCm38)
  • A to G, chromosome 7 at 104,232,909 bp (GRCm38)
  • G to T, chromosome 7 at 105,651,884 bp (GRCm38)
  • A to T, chromosome 7 at 106,689,209 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • G to A, chromosome 8 at 116,957,280 bp (GRCm38)
  • A to T, chromosome 9 at 20,500,004 bp (GRCm38)
  • G to C, chromosome 9 at 99,456,268 bp (GRCm38)
  • A to T, chromosome 9 at 109,721,894 bp (GRCm38)
  • A to C, chromosome 9 at 110,711,135 bp (GRCm38)
  • C to A, chromosome 10 at 13,167,818 bp (GRCm38)
  • G to A, chromosome 10 at 60,307,527 bp (GRCm38)
  • G to A, chromosome 10 at 129,033,952 bp (GRCm38)
  • G to A, chromosome 11 at 73,121,926 bp (GRCm38)
  • A to T, chromosome 11 at 98,155,540 bp (GRCm38)
  • A to G, chromosome 11 at 101,177,311 bp (GRCm38)
  • A to T, chromosome 11 at 106,813,798 bp (GRCm38)
  • A to T, chromosome 12 at 51,392,241 bp (GRCm38)
  • G to A, chromosome 12 at 86,244,109 bp (GRCm38)
  • A to T, chromosome 13 at 48,586,691 bp (GRCm38)
  • A to G, chromosome 15 at 76,372,968 bp (GRCm38)
  • G to A, chromosome 15 at 82,182,156 bp (GRCm38)
  • A to G, chromosome 16 at 19,566,607 bp (GRCm38)
  • G to A, chromosome 16 at 30,308,276 bp (GRCm38)
  • A to C, chromosome 16 at 37,208,080 bp (GRCm38)
  • A to G, chromosome 16 at 50,224,660 bp (GRCm38)
  • T to A, chromosome 16 at 93,760,308 bp (GRCm38)
  • C to T, chromosome 18 at 12,450,484 bp (GRCm38)
  • G to A, chromosome 18 at 32,080,160 bp (GRCm38)
  • A to G, chromosome 18 at 60,270,823 bp (GRCm38)
  • C to T, chromosome 18 at 77,414,130 bp (GRCm38)
  • A to T, chromosome 19 at 12,058,909 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9284 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069103-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.