Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9284Btlr/Mmmh
Stock Number:
069103-MU
Citation ID:
RRID:MMRRC_069103-MU
Other Names:
R9284 (G1)
Major Collection:

Strain Information

Sparcl1
Name: SPARC-like 1
Synonyms: Sc1, hevin, mast9, Ecm2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13602
Homologene: 3438
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Ccdc12
Name: coiled-coil domain containing 12
Synonyms: 2700094L05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72654
Homologene: 41751
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 85,579,642 bp (GRCm38)
  • T to A, chromosome 1 at 155,137,528 bp (GRCm38)
  • T to C, chromosome 1 at 182,973,812 bp (GRCm38)
  • G to A, chromosome 2 at 27,104,043 bp (GRCm38)
  • G to T, chromosome 2 at 30,266,867 bp (GRCm38)
  • A to T, chromosome 2 at 38,748,878 bp (GRCm38)
  • T to C, chromosome 2 at 52,108,552 bp (GRCm38)
  • C to T, chromosome 2 at 72,398,411 bp (GRCm38)
  • T to A, chromosome 2 at 88,093,934 bp (GRCm38)
  • T to C, chromosome 2 at 90,718,031 bp (GRCm38)
  • T to C, chromosome 2 at 120,174,249 bp (GRCm38)
  • T to G, chromosome 2 at 127,291,036 bp (GRCm38)
  • G to T, chromosome 3 at 28,539,421 bp (GRCm38)
  • A to T, chromosome 3 at 79,092,703 bp (GRCm38)
  • T to A, chromosome 3 at 87,931,684 bp (GRCm38)
  • A to T, chromosome 3 at 154,698,671 bp (GRCm38)
  • A to G, chromosome 4 at 99,031,243 bp (GRCm38)
  • T to C, chromosome 4 at 143,397,199 bp (GRCm38)
  • T to G, chromosome 4 at 144,777,621 bp (GRCm38)
  • T to A, chromosome 4 at 148,459,080 bp (GRCm38)
  • T to A, chromosome 5 at 29,442,534 bp (GRCm38)
  • T to G, chromosome 5 at 53,653,382 bp (GRCm38)
  • T to A, chromosome 5 at 81,509,721 bp (GRCm38)
  • A to G, chromosome 5 at 87,008,281 bp (GRCm38)
  • A to T, chromosome 5 at 104,088,479 bp (GRCm38)
  • T to C, chromosome 5 at 125,787,647 bp (GRCm38)
  • T to A, chromosome 5 at 145,440,494 bp (GRCm38)
  • A to T, chromosome 6 at 146,354,676 bp (GRCm38)
  • C to A, chromosome 7 at 3,411,230 bp (GRCm38)
  • A to G, chromosome 7 at 29,705,581 bp (GRCm38)
  • A to G, chromosome 7 at 45,361,798 bp (GRCm38)
  • A to G, chromosome 7 at 104,232,909 bp (GRCm38)
  • G to T, chromosome 7 at 105,651,884 bp (GRCm38)
  • A to T, chromosome 7 at 106,689,209 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • G to A, chromosome 8 at 116,957,280 bp (GRCm38)
  • A to T, chromosome 9 at 20,500,004 bp (GRCm38)
  • G to C, chromosome 9 at 99,456,268 bp (GRCm38)
  • A to T, chromosome 9 at 109,721,894 bp (GRCm38)
  • A to C, chromosome 9 at 110,711,135 bp (GRCm38)
  • C to A, chromosome 10 at 13,167,818 bp (GRCm38)
  • G to A, chromosome 10 at 60,307,527 bp (GRCm38)
  • G to A, chromosome 10 at 129,033,952 bp (GRCm38)
  • G to A, chromosome 11 at 73,121,926 bp (GRCm38)
  • A to T, chromosome 11 at 98,155,540 bp (GRCm38)
  • A to G, chromosome 11 at 101,177,311 bp (GRCm38)
  • A to T, chromosome 11 at 106,813,798 bp (GRCm38)
  • A to T, chromosome 12 at 51,392,241 bp (GRCm38)
  • G to A, chromosome 12 at 86,244,109 bp (GRCm38)
  • A to T, chromosome 13 at 48,586,691 bp (GRCm38)
  • A to G, chromosome 15 at 76,372,968 bp (GRCm38)
  • G to A, chromosome 15 at 82,182,156 bp (GRCm38)
  • A to G, chromosome 16 at 19,566,607 bp (GRCm38)
  • G to A, chromosome 16 at 30,308,276 bp (GRCm38)
  • A to C, chromosome 16 at 37,208,080 bp (GRCm38)
  • A to G, chromosome 16 at 50,224,660 bp (GRCm38)
  • T to A, chromosome 16 at 93,760,308 bp (GRCm38)
  • C to T, chromosome 18 at 12,450,484 bp (GRCm38)
  • G to A, chromosome 18 at 32,080,160 bp (GRCm38)
  • A to G, chromosome 18 at 60,270,823 bp (GRCm38)
  • C to T, chromosome 18 at 77,414,130 bp (GRCm38)
  • A to T, chromosome 19 at 12,058,909 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9284 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069103-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.