Strain Name:
C57BL/6J-MtgxR9285Btlr/Mmmh
Stock Number:
069104-MU
Citation ID:
RRID:MMRRC_069104-MU
Other Names:
R9285 (G1)
Major Collection:

Strain Information

Sulf2
Name: sulfatase 2
Synonyms: 2010004N24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72043
Homologene: 10313
Pibf1
Name: progesterone immunomodulatory binding factor 1
Synonyms: 1700017E21Rik, D14Ertd581e, 4933438D16Rik, 4930513H15Rik, 4933439E17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52023
VEGA: 14
Homologene: 4628
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Phr1, C130061D10Rik, Pam
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Dock9
Name: dedicator of cytokinesis 9
Synonyms: Zizimin1, B230309H04Rik, D14Wsu89e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Lima1
Name: LIM domain and actin binding 1
Synonyms: 3526402A12Rik, 1110021C24Rik, epithelial protein lost in neoplasm, EPLIN
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 65970
Homologene: 9484
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, 9330188B09Rik, D630001M17Rik, 4921513O20Rik, LOC381026
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Kansl3
Name: KAT8 regulatory NSL complex subunit 3
Synonyms: 4632411B12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226976
Homologene: 9949
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72205
Homologene: 8125
Eme2
Name: essential meiotic structure-specific endonuclease subunit 2
Synonyms: 2810013J18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193838
Homologene: 19180
Sass6
Name: SAS-6 centriolar assembly protein
Synonyms: 2810453L12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72776
Homologene: 45668
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: D430002O22Rik, LOC381127, D930044O18Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Chst9
Name: carbohydrate sulfotransferase 9
Synonyms: GalNAc4ST-2, 5430438D01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71367
Homologene: 12861
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Cyp7b1
Name: cytochrome P450, family 7, subfamily b, polypeptide 1
Synonyms: D3Ertd552e, hct-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13123
HGNC: HGNC:2652
Homologene: 3544
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Kcnma3, Slo3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Xylt2
Name: xylosyltransferase II
Synonyms: E030002B02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217119
Homologene: 23349
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Prp9-1, Chd7, 2600010P09Rik, Mi-2 alpha, Prp7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Myog
Name: myogenin
Synonyms: myo, bHLHc3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17928
HGNC: HGNC:7612
Homologene: 1854
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207618
Homologene: 52304
Atp2c2
Name: ATPase, Ca++ transporting, type 2C, member 2
Synonyms: 1810010G06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69047
Homologene: 73463
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Mgat3
Name: mannoside acetylglucosaminyltransferase 3
Synonyms: GnT-III, 1110038J12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17309
VEGA: 15
HGNC: HGNC:7046
Homologene: 31088
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73173
Homologene: 10389
Tektl1
Name: tektin like 1
Synonyms: 4931413A09Rik, Ccdc105
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70976
VEGA: 10
Homologene: 18299
Map3k6
Name: mitogen-activated protein kinase kinase kinase 6
Synonyms: Ask2, MEKK6, MAPKKK6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53608
HGNC: HGNC:6858
Homologene: 3435
Or5p5
Name: olfactory receptor family 5 subfamily P member 5
Synonyms: MOR204-33P, GA_x6K02T2PBJ9-10144091-10145011, Olfr467
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257919
Homologene: 81542
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Sh2bpsm1, Irip, SH2-B, SH2-Bb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Ctsll3
Name: cathepsin L-like 3
Synonyms: 2310051M13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70202
VEGA: 13
Homologene: 134916
Ptk2b
Name: PTK2 protein tyrosine kinase 2 beta
Synonyms: Raftk, CAKbeta, cellular adhesion kinase beta, proline-rich tyrosine kinase 2, related adhesion focal tyrosine kinase, E430023O05Rik, PYK2, calcium-dependent tyrosine kinase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19229
HGNC: HGNC:9612
Homologene: 23001
Zfp983
Name: zinc finger protein 983
Synonyms: 3110052M02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73229
VEGA: 17
Or4k2
Name: olfactory receptor family 4 subfamily K member 2
Synonyms: GA_x6K02T2PMLR-5881670-5880717, MOR247-1, Olfr730
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258486
Homologene: 17269
Or4s2b
Name: olfactory receptor family 4 subfamily S member 2B
Synonyms: Olfr1193, Olfr1194-ps1, GA_x6K02T2Q125-50158288-50158818, MOR226-1, GA_x6K02T2Q125-50154044-50154826, MOR230-9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329460
Homologene: 27297
Sun5
Name: Sad1 and UNC84 domain containing 5
Synonyms: Spag4l, 1700021O15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76407
Homologene: 12640
Or2ag1
Name: olfactory receptor family 2 subfamily AG member 1
Synonyms: MOR283-2, GA_x6K02T2PBJ9-9256348-9255398, Olfr705
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259034
Homologene: 128075
Ggcx
Name: gamma-glutamyl carboxylase
Synonyms: vitamin K-dependent carboxylase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56316
HGNC: HGNC:4247
Homologene: 639
Ptx4
Name: pentraxin 4
Synonyms: 1110018H23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68509
VEGA: 17
Homologene: 19179
Spatc1l
Name: spermatogenesis and centriole associated 1 like
Synonyms: 1700022B01Rik, 1700027D21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76573
HGNC: HGNC:1298
Homologene: 75292
Gprin1
Name: G protein-regulated inducer of neurite outgrowth 1
Synonyms: GRIN1, Z16
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26913
Homologene: 8072
Or5k15
Name: olfactory receptor family 5 subfamily J member 15
Synonyms: MOR184-6, Olfr178, GA_x54KRFPKG5P-55108059-55107100
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258999
Homologene: 79412
Gm20939
Name: predicted gene, 20939
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100044193
VEGA: 17
Ighv2-2
Name: immunoglobulin heavy variable 2-2
Synonyms: Gm16970
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 777686
Gm44511
Name: predicted gene 44511
Type: Gene
Species: Mouse
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 36,344,067 bp (GRCm38)
  • T to C, chromosome 1 at 134,291,157 bp (GRCm38)
  • T to A, chromosome 2 at 88,678,336 bp (GRCm38)
  • T to C, chromosome 2 at 121,364,798 bp (GRCm38)
  • T to C, chromosome 2 at 153,867,506 bp (GRCm38)
  • T to A, chromosome 2 at 166,093,515 bp (GRCm38)
  • T to A, chromosome 3 at 18,097,400 bp (GRCm38)
  • A to G, chromosome 3 at 49,753,337 bp (GRCm38)
  • C to A, chromosome 3 at 116,628,705 bp (GRCm38)
  • C to T, chromosome 4 at 58,084,809 bp (GRCm38)
  • T to A, chromosome 4 at 133,245,559 bp (GRCm38)
  • T to C, chromosome 5 at 6,770,723 bp (GRCm38)
  • T to A, chromosome 6 at 72,418,419 bp (GRCm38)
  • G to T, chromosome 6 at 128,549,793 bp (GRCm38)
  • T to C, chromosome 6 at 128,800,054 bp (GRCm38)
  • A to G, chromosome 7 at 19,191,643 bp (GRCm38)
  • T to C, chromosome 7 at 106,873,508 bp (GRCm38)
  • C to T, chromosome 7 at 107,814,614 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • A to T, chromosome 8 at 15,906,088 bp (GRCm38)
  • T to A, chromosome 8 at 25,891,583 bp (GRCm38)
  • A to C, chromosome 8 at 94,472,976 bp (GRCm38)
  • A to G, chromosome 8 at 95,726,118 bp (GRCm38)
  • A to G, chromosome 8 at 119,738,402 bp (GRCm38)
  • T to C, chromosome 10 at 76,562,430 bp (GRCm38)
  • C to A, chromosome 10 at 78,752,400 bp (GRCm38)
  • G to T, chromosome 11 at 69,359,128 bp (GRCm38)
  • A to T, chromosome 11 at 94,667,710 bp (GRCm38)
  • A to T, chromosome 12 at 113,588,283 bp (GRCm38)
  • A to G, chromosome 13 at 54,738,710 bp (GRCm38)
  • T to A, chromosome 13 at 60,798,588 bp (GRCm38)
  • A to C, chromosome 14 at 50,186,665 bp (GRCm38)
  • A to T, chromosome 14 at 66,173,395 bp (GRCm38)
  • C to T, chromosome 14 at 99,242,909 bp (GRCm38)
  • T to A, chromosome 14 at 103,197,317 bp (GRCm38)
  • A to C, chromosome 14 at 121,595,600 bp (GRCm38)
  • A to G, chromosome 15 at 80,212,337 bp (GRCm38)
  • T to C, chromosome 15 at 82,100,969 bp (GRCm38)
  • T to A, chromosome 15 at 91,778,483 bp (GRCm38)
  • T to C, chromosome 15 at 99,780,806 bp (GRCm38)
  • T to A, chromosome 16 at 58,890,206 bp (GRCm38)
  • T to A, chromosome 17 at 21,657,604 bp (GRCm38)
  • T to C, chromosome 17 at 24,889,158 bp (GRCm38)
  • T to G, chromosome 17 at 25,124,956 bp (GRCm38)
  • T to C, chromosome 17 at 94,876,760 bp (GRCm38)
  • T to A, chromosome 18 at 15,452,960 bp (GRCm38)
  • A to T, chromosome 18 at 22,521,932 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9285 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069104-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.