Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9286Btlr/Mmmh
Stock Number:
069105-MU
Citation ID:
RRID:MMRRC_069105-MU
Other Names:
R9286 (G1)
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Slc17a5
Name: solute carrier family 17 (anion/sugar transporter), member 5
Synonyms: 4631416G20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235504
Homologene: 56571
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Llgl2
Name: LLGL2 scribble cell polarity complex component
Synonyms: 9130006H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217325
HGNC: HGNC:6629
Homologene: 3323
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 36,348,639 bp (GRCm38)
  • T to G, chromosome 1 at 67,158,871 bp (GRCm38)
  • A to G, chromosome 1 at 79,435,936 bp (GRCm38)
  • A to G, chromosome 1 at 91,552,428 bp (GRCm38)
  • A to T, chromosome 1 at 119,471,814 bp (GRCm38)
  • G to T, chromosome 1 at 154,413,099 bp (GRCm38)
  • G to A, chromosome 1 at 160,224,248 bp (GRCm38)
  • A to G, chromosome 2 at 30,383,597 bp (GRCm38)
  • A to T, chromosome 2 at 156,292,550 bp (GRCm38)
  • G to A, chromosome 2 at 170,830,179 bp (GRCm38)
  • T to C, chromosome 3 at 97,699,867 bp (GRCm38)
  • C to T, chromosome 3 at 127,052,732 bp (GRCm38)
  • CCTTCTT to CCTT, chromosome 3 at 127,546,359 bp (GRCm38)
  • T to C, chromosome 4 at 126,890,019 bp (GRCm38)
  • A to G, chromosome 5 at 35,389,432 bp (GRCm38)
  • A to T, chromosome 5 at 81,646,566 bp (GRCm38)
  • A to G, chromosome 5 at 140,425,309 bp (GRCm38)
  • A to G, chromosome 5 at 151,575,710 bp (GRCm38)
  • A to G, chromosome 6 at 24,603,713 bp (GRCm38)
  • T to A, chromosome 6 at 89,715,097 bp (GRCm38)
  • C to A, chromosome 6 at 142,430,311 bp (GRCm38)
  • G to T, chromosome 7 at 25,916,966 bp (GRCm38)
  • T to C, chromosome 7 at 35,627,444 bp (GRCm38)
  • A to G, chromosome 7 at 83,603,435 bp (GRCm38)
  • A to G, chromosome 7 at 97,998,432 bp (GRCm38)
  • A to C, chromosome 7 at 105,336,764 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • A to G, chromosome 8 at 117,605,237 bp (GRCm38)
  • T to A, chromosome 8 at 126,025,409 bp (GRCm38)
  • C to T, chromosome 9 at 6,941,668 bp (GRCm38)
  • G to A, chromosome 9 at 67,972,921 bp (GRCm38)
  • A to T, chromosome 9 at 78,538,284 bp (GRCm38)
  • T to C, chromosome 10 at 39,806,951 bp (GRCm38)
  • G to A, chromosome 10 at 60,307,527 bp (GRCm38)
  • T to A, chromosome 10 at 76,302,262 bp (GRCm38)
  • C to A, chromosome 10 at 77,941,180 bp (GRCm38)
  • T to A, chromosome 11 at 40,736,576 bp (GRCm38)
  • T to G, chromosome 11 at 69,026,354 bp (GRCm38)
  • T to A, chromosome 11 at 71,169,747 bp (GRCm38)
  • T to C, chromosome 11 at 115,850,018 bp (GRCm38)
  • A to C, chromosome 12 at 53,072,471 bp (GRCm38)
  • A to G, chromosome 12 at 83,728,775 bp (GRCm38)
  • A to G, chromosome 13 at 49,530,220 bp (GRCm38)
  • A to G, chromosome 13 at 56,625,750 bp (GRCm38)
  • A to T, chromosome 13 at 77,043,813 bp (GRCm38)
  • A to T, chromosome 13 at 81,446,401 bp (GRCm38)
  • T to C, chromosome 14 at 7,873,414 bp (GRCm38)
  • G to A, chromosome 14 at 52,410,618 bp (GRCm38)
  • A to G, chromosome 14 at 52,851,593 bp (GRCm38)
  • A to G, chromosome 15 at 73,125,216 bp (GRCm38)
  • G to A, chromosome 15 at 76,631,013 bp (GRCm38)
  • A to G, chromosome 15 at 82,559,202 bp (GRCm38)
  • G to C, chromosome 15 at 91,174,624 bp (GRCm38)
  • A to T, chromosome 15 at 102,133,434 bp (GRCm38)
  • T to C, chromosome 16 at 26,698,854 bp (GRCm38)
  • A to G, chromosome 16 at 57,046,969 bp (GRCm38)
  • A to G, chromosome 16 at 77,107,976 bp (GRCm38)
  • T to C, chromosome 16 at 88,051,427 bp (GRCm38)
  • T to C, chromosome 17 at 33,302,709 bp (GRCm38)
  • A to T, chromosome 17 at 49,479,894 bp (GRCm38)
  • T to A, chromosome 18 at 37,486,369 bp (GRCm38)
  • A to G, chromosome 18 at 88,977,725 bp (GRCm38)
  • T to A, chromosome 19 at 13,502,427 bp (GRCm38)
  • A to T, chromosome 19 at 42,597,608 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9286 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069105-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.