Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9288Btlr/Mmmh
Stock Number:
069107-MU
Citation ID:
RRID:MMRRC_069107-MU
Other Names:
R9288 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Olr1
Name: oxidized low density lipoprotein (lectin-like) receptor 1
Synonyms: LOX-1, Scare1, SR-EI
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108078
HGNC: HGNC:8133
Homologene: 1910
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 12,786,603 bp (GRCm38)
  • T to C, chromosome 1 at 93,409,051 bp (GRCm38)
  • G to A, chromosome 1 at 166,152,735 bp (GRCm38)
  • A to G, chromosome 1 at 187,112,559 bp (GRCm38)
  • T to G, chromosome 2 at 52,161,391 bp (GRCm38)
  • G to T, chromosome 2 at 156,704,594 bp (GRCm38)
  • C to A, chromosome 2 at 160,903,632 bp (GRCm38)
  • C to T, chromosome 3 at 37,320,563 bp (GRCm38)
  • T to A, chromosome 3 at 88,536,151 bp (GRCm38)
  • T to C, chromosome 3 at 95,891,915 bp (GRCm38)
  • T to C, chromosome 4 at 6,414,976 bp (GRCm38)
  • C to T, chromosome 4 at 96,013,268 bp (GRCm38)
  • T to C, chromosome 4 at 127,022,834 bp (GRCm38)
  • T to C, chromosome 4 at 141,747,080 bp (GRCm38)
  • T to A, chromosome 4 at 152,206,806 bp (GRCm38)
  • A to T, chromosome 4 at 155,784,276 bp (GRCm38)
  • A to T, chromosome 5 at 25,292,909 bp (GRCm38)
  • A to T, chromosome 5 at 25,349,862 bp (GRCm38)
  • A to T, chromosome 5 at 108,802,319 bp (GRCm38)
  • C to T, chromosome 5 at 115,985,453 bp (GRCm38)
  • A to G, chromosome 5 at 134,192,732 bp (GRCm38)
  • A to G, chromosome 6 at 18,051,369 bp (GRCm38)
  • G to A, chromosome 6 at 90,309,524 bp (GRCm38)
  • T to C, chromosome 6 at 129,493,239 bp (GRCm38)
  • T to C, chromosome 7 at 82,868,951 bp (GRCm38)
  • GGCGGCGGC to GGCGGCGGCCGCGGCGGC, chromosome 7 at 97,579,912 bp (GRCm38)
  • GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA to GCAGCCCCCACAGGA, chromosome 7 at 142,165,288 bp (GRCm38)
  • G to T, chromosome 8 at 74,892,811 bp (GRCm38)
  • A to G, chromosome 9 at 31,341,378 bp (GRCm38)
  • A to G, chromosome 9 at 42,041,631 bp (GRCm38)
  • T to C, chromosome 9 at 116,110,081 bp (GRCm38)
  • A to G, chromosome 10 at 25,479,755 bp (GRCm38)
  • T to A, chromosome 10 at 116,319,448 bp (GRCm38)
  • T to G, chromosome 11 at 29,838,641 bp (GRCm38)
  • A to T, chromosome 11 at 59,085,223 bp (GRCm38)
  • T to A, chromosome 11 at 94,418,071 bp (GRCm38)
  • C to T, chromosome 11 at 94,573,218 bp (GRCm38)
  • G to T, chromosome 11 at 100,456,893 bp (GRCm38)
  • T to C, chromosome 11 at 109,813,618 bp (GRCm38)
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp (GRCm38)
  • T to A, chromosome 12 at 72,476,084 bp (GRCm38)
  • A to T, chromosome 12 at 101,768,469 bp (GRCm38)
  • G to T, chromosome 13 at 73,847,058 bp (GRCm38)
  • CGAGG to CGAGGAGG, chromosome 13 at 105,250,273 bp (GRCm38)
  • A to C, chromosome 14 at 7,904,498 bp (GRCm38)
  • C to A, chromosome 14 at 21,831,894 bp (GRCm38)
  • A to T, chromosome 14 at 30,661,458 bp (GRCm38)
  • A to T, chromosome 14 at 54,985,475 bp (GRCm38)
  • T to C, chromosome 14 at 101,454,872 bp (GRCm38)
  • A to C, chromosome 15 at 4,806,050 bp (GRCm38)
  • T to A, chromosome 15 at 55,423,522 bp (GRCm38)
  • A to G, chromosome 17 at 22,603,342 bp (GRCm38)
  • A to G, chromosome 17 at 40,910,125 bp (GRCm38)
  • A to G, chromosome 18 at 12,771,345 bp (GRCm38)
  • G to T, chromosome 18 at 54,900,269 bp (GRCm38)
  • C to T, chromosome 18 at 62,922,660 bp (GRCm38)
  • T to C, chromosome 19 at 17,836,981 bp (GRCm38)
  • A to G, chromosome 19 at 23,945,781 bp (GRCm38)
  • A to T, chromosome 19 at 41,624,705 bp (GRCm38)
  • T to C, chromosome 19 at 45,558,842 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9288 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069107-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.