Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9314Btlr/Mmmh
Stock Number:
069127-MU
Citation ID:
RRID:MMRRC_069127-MU
Other Names:
R9314 (G1)
Major Collection:

Strain Information

Sphk2
Name: sphingosine kinase 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56632
Homologene: 32456
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Emb
Name: embigin
Synonyms: Gp70
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13723
Homologene: 7743
Madcam1
Name: mucosal vascular addressin cell adhesion molecule 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17123
VEGA: 10
HGNC: HGNC:6765
Homologene: 8413
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Tbcd
Name: tubulin-specific chaperone d
Synonyms: A030005L14Rik, 2310057L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108903
Homologene: 4368
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, Def-5, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Supt5
Name: suppressor of Ty 5, DSIF elongation factor subunit
Synonyms: Spt5, Supt5h
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20924
Homologene: 2384
Wdr3
Name: WD repeat domain 3
Synonyms: D030020G18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269470
Homologene: 4937
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: ESR, ERalpha, ER[a], Nr3a1, ERa, Estr, Estra, ER-alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Txnl4b
Name: thioredoxin-like 4B
Synonyms: Dim2, D530025J19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234723
Homologene: 9880
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Lrrtm3
Name: leucine rich repeat transmembrane neuronal 3
Synonyms: 9630044H04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216028
Homologene: 37110
Zfp59
Name: zinc finger protein 59
Synonyms: Mfg-2, Mfg2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22717
Homologene: 137243
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Supt3
Name: SPT3, SAGA and STAGA complex component
Synonyms: SPT3L, SPT3, 2310066G22Rik, Supt3h
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 109115
Homologene: 121570
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Tmprss2
Name: transmembrane protease, serine 2
Synonyms: epitheliasin, D16Ertd61e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50528
VEGA: 16
Homologene: 4136
Vit
Name: vitrin
Synonyms: 1700110E08Rik, 1700052E02Rik, 2810429K11Rik, AKH, akhirin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
Kdm2a
Name: lysine (K)-specific demethylase 2A
Synonyms: Cxxc8, Fbl7, lalina, Jhdm1a, Fbxl11, Gm4560, 5530401A10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225876
Homologene: 56564
Cd207
Name: CD207 antigen
Synonyms: Langerin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 246278
Homologene: 9252
Kdelr1
Name: KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Synonyms: 8030486F04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68137
HGNC: HGNC:6304
Homologene: 38236
Sgtb
Name: small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Synonyms: C630001O05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218544
Homologene: 10409
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: 1300003D15Rik, Epac2, cAMP-GEFII, 5730402K07Rik, 6330581N18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Slc7a1
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 1
Synonyms: Rev-1, Rec-1, Atrc-1, Atrc1, 4831426K01Rik, mCAT-1, Cat1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11987
Homologene: 20658
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Lox
Name: lysyl oxidase
Synonyms: ras recision gene (rrg), TSC-160
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16948
VEGA: 18
HGNC: HGNC:6664
Homologene: 1741
Slc22a5
Name: solute carrier family 22 (organic cation transporter), member 5
Synonyms: Octn2, Lstpl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20520
Homologene: 68295
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b288Clo, b2b1702Clo, m687Ddg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Trnau1ap
Name: tRNA selenocysteine 1 associated protein 1
Synonyms: 1110007F05Rik, SECp43, Trspap1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71787
Homologene: 49509
Evpl
Name: envoplakin
Synonyms: 210kDa protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14027
HGNC: HGNC:3503
Homologene: 1506
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Slc34a2
Name: solute carrier family 34 (sodium phosphate), member 2
Synonyms: type IIb Na/Picotransporter, Npt2b, NaPi-2b, D5Ertd227e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20531
Homologene: 2297
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17836
HGNC: HGNC:9750
Homologene: 136663
Naaladl1
Name: N-acetylated alpha-linked acidic dipeptidase-like 1
Synonyms: LOC381204
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381204
Homologene: 21124
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Calr3
Name: calreticulin 3
Synonyms: Crt2, 1700031L01Rik, 6330586I20Rik, calsperin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73316
Homologene: 57091
Spty2d1
Name: SPT2 chromatin protein domain containing 1
Synonyms: 5830435K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101685
Homologene: 45499
Or52b1
Name: olfactory receptor family 52 subfamily B member 1
Synonyms: GA_x6K02T2PBJ9-7959171-7958224, MOR31-2, Olfr690
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56860
Homologene: 10653
Rassf8
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms: mHoj-1, 5133400D11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71323
Homologene: 5219
Tmc4
Name: transmembrane channel-like gene family 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 353499
Homologene: 16971
Ube4a
Name: ubiquitination factor E4A
Synonyms: UFD2b, 9930123J21Rik, 4732444G18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 140630
Homologene: 3517
Lamp3
Name: lysosomal-associated membrane protein 3
Synonyms: Cd208, 1200002D17Rik, DC-LAMP, TSC403
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239739
VEGA: 16
Homologene: 8670
Poll
Name: polymerase (DNA directed), lambda
Synonyms: 1110003P06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56626
VEGA: 19
HGNC: HGNC:9184
Homologene: 40863
Or5a1
Name: olfactory receptor family 5 subfamily A member 1
Synonyms: V5, MOR215-3, GA_x6K02T2RE5P-2479601-2478648, Olfr76
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258677
HGNC: HGNC:8319
Homologene: 17342
Krt36
Name: keratin 36
Synonyms: HRa-1, Krt1-22, keratin 5, Krt1-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16673
HGNC: HGNC:6454
Homologene: 88459
Setdb2
Name: SET domain, bifurcated 2
Synonyms: LOC239122, KMT1F
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239122
Homologene: 12903
Ifit1bl1
Name: interferon induced protein with tetratricpeptide repeats 1B like 1
Synonyms: Gm14446
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 667373
Homologene: 78213
Slc19a3
Name: solute carrier family 19, member 3
Synonyms: ThTr2, A230084E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 80721
Homologene: 23530
Thrb
Name: thyroid hormone receptor beta
Synonyms: T3Rbeta, T3R[b], Nr1a2, TR beta, c-erbAbeta, Thrb2, Thrb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21834
Homologene: 36025
Slc37a2
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 2
Synonyms: cI-2, G3PP, Slc37a1, ci2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56857
Homologene: 41357
Ighg3
Name: Immunoglobulin heavy constant gamma 3
Synonyms: IgG3, AI324046
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380795
Muc1
Name: mucin 1, transmembrane
Synonyms: EMA, CD227, Muc-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17829
HGNC: HGNC:7508
Homologene: 137248
Ppl
Name: periplakin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Prss53
Name: serine protease 53
Synonyms: BC039632
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330657
Homologene: 80097
Gm5591
Name: predicted gene 5591
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434171
Homologene: 80005
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 83,022,373 bp (GRCm38)
  • C to T, chromosome 1 at 164,201,577 bp (GRCm38)
  • A to T, chromosome 2 at 72,234,639 bp (GRCm38)
  • A to G, chromosome 2 at 76,736,366 bp (GRCm38)
  • A to G, chromosome 2 at 90,471,287 bp (GRCm38)
  • G to A, chromosome 2 at 128,622,500 bp (GRCm38)
  • T to C, chromosome 3 at 89,231,518 bp (GRCm38)
  • T to C, chromosome 3 at 100,142,972 bp (GRCm38)
  • C to T, chromosome 4 at 58,070,347 bp (GRCm38)
  • T to C, chromosome 4 at 85,006,482 bp (GRCm38)
  • C to A, chromosome 4 at 132,329,386 bp (GRCm38)
  • A to G, chromosome 5 at 31,077,644 bp (GRCm38)
  • T to C, chromosome 5 at 53,060,801 bp (GRCm38)
  • T to C, chromosome 5 at 121,299,645 bp (GRCm38)
  • T to C, chromosome 5 at 148,332,517 bp (GRCm38)
  • A to G, chromosome 5 at 150,550,894 bp (GRCm38)
  • T to A, chromosome 6 at 83,675,717 bp (GRCm38)
  • T to G, chromosome 6 at 121,857,337 bp (GRCm38)
  • A to G, chromosome 6 at 145,816,570 bp (GRCm38)
  • T to C, chromosome 7 at 3,676,724 bp (GRCm38)
  • T to A, chromosome 7 at 25,329,872 bp (GRCm38)
  • C to T, chromosome 7 at 27,854,604 bp (GRCm38)
  • T to A, chromosome 7 at 28,320,374 bp (GRCm38)
  • T to C, chromosome 7 at 38,522,460 bp (GRCm38)
  • T to C, chromosome 7 at 45,711,734 bp (GRCm38)
  • A to G, chromosome 7 at 45,881,626 bp (GRCm38)
  • G to T, chromosome 7 at 46,998,738 bp (GRCm38)
  • A to G, chromosome 7 at 48,168,426 bp (GRCm38)
  • A to T, chromosome 7 at 105,329,874 bp (GRCm38)
  • A to G, chromosome 7 at 127,890,867 bp (GRCm38)
  • ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,710 bp (GRCm38)
  • T to A, chromosome 8 at 31,201,476 bp (GRCm38)
  • T to A, chromosome 8 at 72,424,691 bp (GRCm38)
  • C to A, chromosome 8 at 109,572,699 bp (GRCm38)
  • T to C, chromosome 9 at 37,239,186 bp (GRCm38)
  • T to C, chromosome 9 at 44,942,725 bp (GRCm38)
  • A to G, chromosome 9 at 111,365,981 bp (GRCm38)
  • T to A, chromosome 10 at 4,966,181 bp (GRCm38)
  • T to C, chromosome 10 at 64,089,720 bp (GRCm38)
  • C to A, chromosome 10 at 79,665,647 bp (GRCm38)
  • A to T, chromosome 11 at 8,879,153 bp (GRCm38)
  • T to C, chromosome 11 at 53,871,661 bp (GRCm38)
  • A to G, chromosome 11 at 67,260,315 bp (GRCm38)
  • C to T, chromosome 11 at 100,103,401 bp (GRCm38)
  • A to T, chromosome 11 at 106,544,249 bp (GRCm38)
  • A to T, chromosome 11 at 116,227,677 bp (GRCm38)
  • T to C, chromosome 11 at 119,895,946 bp (GRCm38)
  • T to C, chromosome 11 at 121,596,471 bp (GRCm38)
  • A to T, chromosome 12 at 113,360,326 bp (GRCm38)
  • A to G, chromosome 12 at 115,765,376 bp (GRCm38)
  • A to G, chromosome 13 at 104,118,425 bp (GRCm38)
  • T to C, chromosome 13 at 117,272,068 bp (GRCm38)
  • A to G, chromosome 14 at 17,963,208 bp (GRCm38)
  • A to T, chromosome 14 at 59,412,791 bp (GRCm38)
  • T to C, chromosome 16 at 5,104,503 bp (GRCm38)
  • T to C, chromosome 16 at 19,673,442 bp (GRCm38)
  • T to C, chromosome 16 at 97,599,259 bp (GRCm38)
  • A to C, chromosome 17 at 24,328,619 bp (GRCm38)
  • A to T, chromosome 17 at 30,771,883 bp (GRCm38)
  • A to G, chromosome 17 at 45,041,363 bp (GRCm38)
  • A to T, chromosome 17 at 78,619,615 bp (GRCm38)
  • C to G, chromosome 18 at 52,520,839 bp (GRCm38)
  • A to G, chromosome 19 at 4,322,482 bp (GRCm38)
  • A to C, chromosome 19 at 6,112,371 bp (GRCm38)
  • C to T, chromosome 19 at 12,119,780 bp (GRCm38)
  • G to C, chromosome 19 at 34,599,293 bp (GRCm38)
  • T to C, chromosome 19 at 45,558,652 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9314 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069127-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.