Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9314Btlr/Mmmh
Stock Number:
069127-MU
Citation ID:
RRID:MMRRC_069127-MU
Other Names:
R9314 (G1)
Major Collection:

Strain Information

Sphk2
Name: sphingosine kinase 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56632
Homologene: 32456
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Emb
Name: embigin
Synonyms: Gp70
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13723
Homologene: 7743
Madcam1
Name: mucosal vascular addressin cell adhesion molecule 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17123
VEGA: 10
HGNC: HGNC:6765
Homologene: 8413
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Tbcd
Name: tubulin-specific chaperone d
Synonyms: A030005L14Rik, 2310057L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108903
Homologene: 4368
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 83,022,373 bp (GRCm38)
  • C to T, chromosome 1 at 164,201,577 bp (GRCm38)
  • A to T, chromosome 2 at 72,234,639 bp (GRCm38)
  • A to G, chromosome 2 at 76,736,366 bp (GRCm38)
  • A to G, chromosome 2 at 90,471,287 bp (GRCm38)
  • G to A, chromosome 2 at 128,622,500 bp (GRCm38)
  • T to C, chromosome 3 at 89,231,518 bp (GRCm38)
  • T to C, chromosome 3 at 100,142,972 bp (GRCm38)
  • C to T, chromosome 4 at 58,070,347 bp (GRCm38)
  • T to C, chromosome 4 at 85,006,482 bp (GRCm38)
  • C to A, chromosome 4 at 132,329,386 bp (GRCm38)
  • A to G, chromosome 5 at 31,077,644 bp (GRCm38)
  • T to C, chromosome 5 at 53,060,801 bp (GRCm38)
  • T to C, chromosome 5 at 121,299,645 bp (GRCm38)
  • T to C, chromosome 5 at 148,332,517 bp (GRCm38)
  • A to G, chromosome 5 at 150,550,894 bp (GRCm38)
  • T to A, chromosome 6 at 83,675,717 bp (GRCm38)
  • T to G, chromosome 6 at 121,857,337 bp (GRCm38)
  • A to G, chromosome 6 at 145,816,570 bp (GRCm38)
  • T to C, chromosome 7 at 3,676,724 bp (GRCm38)
  • T to A, chromosome 7 at 25,329,872 bp (GRCm38)
  • C to T, chromosome 7 at 27,854,604 bp (GRCm38)
  • T to A, chromosome 7 at 28,320,374 bp (GRCm38)
  • T to C, chromosome 7 at 38,522,460 bp (GRCm38)
  • T to C, chromosome 7 at 45,711,734 bp (GRCm38)
  • A to G, chromosome 7 at 45,881,626 bp (GRCm38)
  • G to T, chromosome 7 at 46,998,738 bp (GRCm38)
  • A to G, chromosome 7 at 48,168,426 bp (GRCm38)
  • A to T, chromosome 7 at 105,329,874 bp (GRCm38)
  • A to G, chromosome 7 at 127,890,867 bp (GRCm38)
  • ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,710 bp (GRCm38)
  • T to A, chromosome 8 at 31,201,476 bp (GRCm38)
  • T to A, chromosome 8 at 72,424,691 bp (GRCm38)
  • C to A, chromosome 8 at 109,572,699 bp (GRCm38)
  • T to C, chromosome 9 at 37,239,186 bp (GRCm38)
  • T to C, chromosome 9 at 44,942,725 bp (GRCm38)
  • A to G, chromosome 9 at 111,365,981 bp (GRCm38)
  • T to A, chromosome 10 at 4,966,181 bp (GRCm38)
  • T to C, chromosome 10 at 64,089,720 bp (GRCm38)
  • C to A, chromosome 10 at 79,665,647 bp (GRCm38)
  • A to T, chromosome 11 at 8,879,153 bp (GRCm38)
  • T to C, chromosome 11 at 53,871,661 bp (GRCm38)
  • A to G, chromosome 11 at 67,260,315 bp (GRCm38)
  • C to T, chromosome 11 at 100,103,401 bp (GRCm38)
  • A to T, chromosome 11 at 106,544,249 bp (GRCm38)
  • A to T, chromosome 11 at 116,227,677 bp (GRCm38)
  • T to C, chromosome 11 at 119,895,946 bp (GRCm38)
  • T to C, chromosome 11 at 121,596,471 bp (GRCm38)
  • A to T, chromosome 12 at 113,360,326 bp (GRCm38)
  • A to G, chromosome 12 at 115,765,376 bp (GRCm38)
  • A to G, chromosome 13 at 104,118,425 bp (GRCm38)
  • T to C, chromosome 13 at 117,272,068 bp (GRCm38)
  • A to G, chromosome 14 at 17,963,208 bp (GRCm38)
  • A to T, chromosome 14 at 59,412,791 bp (GRCm38)
  • T to C, chromosome 16 at 5,104,503 bp (GRCm38)
  • T to C, chromosome 16 at 19,673,442 bp (GRCm38)
  • T to C, chromosome 16 at 97,599,259 bp (GRCm38)
  • A to C, chromosome 17 at 24,328,619 bp (GRCm38)
  • A to T, chromosome 17 at 30,771,883 bp (GRCm38)
  • A to G, chromosome 17 at 45,041,363 bp (GRCm38)
  • A to T, chromosome 17 at 78,619,615 bp (GRCm38)
  • C to G, chromosome 18 at 52,520,839 bp (GRCm38)
  • A to G, chromosome 19 at 4,322,482 bp (GRCm38)
  • A to C, chromosome 19 at 6,112,371 bp (GRCm38)
  • C to T, chromosome 19 at 12,119,780 bp (GRCm38)
  • G to C, chromosome 19 at 34,599,293 bp (GRCm38)
  • T to C, chromosome 19 at 45,558,652 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9314 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069127-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.