Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9334Btlr/Mmmh
Stock Number:
069146-MU
Citation ID:
RRID:MMRRC_069146-MU
Other Names:
R9334 (G1)
Major Collection:

Strain Information

Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Eif4g2
Name: eukaryotic translation initiation factor 4, gamma 2
Synonyms: Nat1, DAP-5, Natm1, E130105L11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13690
HGNC: HGNC:3297
Homologene: 37477
Gmps
Name: guanine monophosphate synthetase
Synonyms: Gm9479
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229363
HGNC: HGNC:4378
Homologene: 68367
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328977
Homologene: 138627
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 36,700,170 bp (GRCm38)
  • T to C, chromosome 1 at 66,649,760 bp (GRCm38)
  • T to A, chromosome 1 at 105,726,454 bp (GRCm38)
  • T to C, chromosome 1 at 119,802,384 bp (GRCm38)
  • T to C, chromosome 1 at 127,795,309 bp (GRCm38)
  • T to G, chromosome 1 at 153,073,839 bp (GRCm38)
  • T to A, chromosome 1 at 156,888,029 bp (GRCm38)
  • T to A, chromosome 2 at 29,154,020 bp (GRCm38)
  • T to C, chromosome 2 at 70,217,016 bp (GRCm38)
  • C to T, chromosome 2 at 137,101,673 bp (GRCm38)
  • T to A, chromosome 2 at 144,568,630 bp (GRCm38)
  • CCGTGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGTGCCCGTGGTGTACCCCCTCTCTAGTCCTGTGAGCCCGTGGTGTACCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGTGCCCGTGGTGTACCCCCTCTCTAGTCCTGTGAGCCCGTGGTGTACCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGCTCCCATGGTGTGCCCCCTCTCTAGTCCGGCGCTCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCC to CCGTGCCCGTGGTGTACCCCCTCTCTAGTCCTGTGAGCCCGTGGTGTACCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGTGCCCGTGGTGTACCCCCTCTCTAGTCCTGTGAGCCCGTGGTGTACCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGCTCCCATGGTGTGCCCCCTCTCTAGTCCGGCGCTCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCC, chromosome 2 at 164,507,500 bp (GRCm38)
  • T to A, chromosome 3 at 27,335,347 bp (GRCm38)
  • T to A, chromosome 3 at 63,982,443 bp (GRCm38)
  • C to T, chromosome 3 at 131,298,416 bp (GRCm38)
  • A to G, chromosome 4 at 19,890,695 bp (GRCm38)
  • G to A, chromosome 4 at 22,376,778 bp (GRCm38)
  • A to T, chromosome 4 at 88,629,949 bp (GRCm38)
  • G to A, chromosome 4 at 107,064,408 bp (GRCm38)
  • G to A, chromosome 4 at 139,966,182 bp (GRCm38)
  • G to T, chromosome 5 at 52,420,829 bp (GRCm38)
  • A to G, chromosome 5 at 88,672,610 bp (GRCm38)
  • G to T, chromosome 6 at 4,707,205 bp (GRCm38)
  • A to T, chromosome 6 at 82,403,932 bp (GRCm38)
  • G to A, chromosome 6 at 118,532,301 bp (GRCm38)
  • A to T, chromosome 6 at 121,861,531 bp (GRCm38)
  • A to G, chromosome 6 at 125,236,755 bp (GRCm38)
  • G to A, chromosome 6 at 125,677,946 bp (GRCm38)
  • C to T, chromosome 7 at 34,642,058 bp (GRCm38)
  • A to G, chromosome 7 at 46,259,929 bp (GRCm38)
  • A to T, chromosome 7 at 81,611,330 bp (GRCm38)
  • A to T, chromosome 7 at 98,067,162 bp (GRCm38)
  • A to G, chromosome 7 at 111,074,824 bp (GRCm38)
  • T to A, chromosome 8 at 35,803,568 bp (GRCm38)
  • T to C, chromosome 8 at 84,569,965 bp (GRCm38)
  • A to G, chromosome 8 at 109,948,404 bp (GRCm38)
  • T to A, chromosome 8 at 111,627,348 bp (GRCm38)
  • A to T, chromosome 8 at 123,148,407 bp (GRCm38)
  • A to T, chromosome 9 at 62,796,322 bp (GRCm38)
  • A to T, chromosome 9 at 79,818,457 bp (GRCm38)
  • A to G, chromosome 9 at 86,520,974 bp (GRCm38)
  • A to T, chromosome 9 at 104,174,460 bp (GRCm38)
  • A to T, chromosome 10 at 97,568,485 bp (GRCm38)
  • A to T, chromosome 10 at 112,144,043 bp (GRCm38)
  • A to G, chromosome 10 at 129,705,814 bp (GRCm38)
  • A to G, chromosome 11 at 23,655,630 bp (GRCm38)
  • T to C, chromosome 11 at 55,185,039 bp (GRCm38)
  • T to C, chromosome 11 at 59,571,446 bp (GRCm38)
  • T to C, chromosome 11 at 62,875,084 bp (GRCm38)
  • C to A, chromosome 11 at 69,905,966 bp (GRCm38)
  • A to G, chromosome 11 at 84,964,589 bp (GRCm38)
  • T to A, chromosome 12 at 104,473,094 bp (GRCm38)
  • T to C, chromosome 12 at 111,430,683 bp (GRCm38)
  • A to C, chromosome 12 at 113,491,148 bp (GRCm38)
  • T to C, chromosome 13 at 49,524,339 bp (GRCm38)
  • G to T, chromosome 13 at 76,055,984 bp (GRCm38)
  • C to A, chromosome 13 at 76,132,957 bp (GRCm38)
  • G to T, chromosome 13 at 99,431,640 bp (GRCm38)
  • A to G, chromosome 14 at 51,101,560 bp (GRCm38)
  • G to A, chromosome 14 at 55,547,826 bp (GRCm38)
  • A to T, chromosome 15 at 83,628,063 bp (GRCm38)
  • G to A, chromosome 15 at 89,355,374 bp (GRCm38)
  • T to A, chromosome 16 at 22,961,311 bp (GRCm38)
  • C to A, chromosome 16 at 44,419,291 bp (GRCm38)
  • C to T, chromosome 17 at 29,204,699 bp (GRCm38)
  • T to A, chromosome 17 at 38,148,949 bp (GRCm38)
  • A to G, chromosome 18 at 65,623,057 bp (GRCm38)
  • G to A, chromosome 19 at 4,620,504 bp (GRCm38)
  • A to G, chromosome 19 at 6,856,173 bp (GRCm38)
  • G to A, chromosome 19 at 7,600,721 bp (GRCm38)
  • C to T, chromosome 19 at 41,953,764 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9334 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069146-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.