Strain Name:
C57BL/6J-MtgxR9343Btlr/Mmmh
Stock Number:
069154-MU
Citation ID:
RRID:MMRRC_069154-MU
Other Names:
R9343 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Col2a, M100856, Del1, Col2a-1, Lpk, Col2, Rgsc856, Rgsc413, M100413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Mrtfb
Name: myocardin related transcription factor B
Synonyms: Mrtfb, Mkl2, MRTF-B, Gt4-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Npyr, Y1-R
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Phf14
Name: PHD finger protein 14
Synonyms: 4932409F11Rik, 1110001C23Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Pds5b
Name: PDS5 cohesin associated factor B
Synonyms: Aprin, AS3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100710
Homologene: 41001
Strn4
Name: striatin, calmodulin binding protein 4
Synonyms: ZIN, zinedin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 97387
Homologene: 8378
Ppat
Name: phosphoribosyl pyrophosphate amidotransferase
Synonyms: 5730454C12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231327
HGNC: HGNC:9238
Homologene: 68272
S1pr3
Name: sphingosine-1-phosphate receptor 3
Synonyms: S1P3, Edg3, LPb3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13610
VEGA: 13
HGNC: HGNC:3167
Homologene: 3829
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Zcchc17
Name: zinc finger, CCHC domain containing 17
Synonyms: HSPC251, 2810055E05Rik, Ps1d
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 619605
Homologene: 32319
Cnot2
Name: CCR4-NOT transcription complex, subunit 2
Synonyms: 2810470K03Rik, 2600016M12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72068
HGNC: HGNC:7878
Homologene: 40953
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231214
Homologene: 18159
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Mllt3
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms: Af9, D4Ertd321e, 3830408D16Rik, 2210011H10Rik, 2610012I03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70122
HGNC: HGNC:7136
Homologene: 37933
Csf2rb2
Name: colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
Synonyms: AIC2A, Il3r, Il3rb2, BetaIl3, Bil3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12984
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Trh
Name: thyrotropin releasing hormone
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22044
Homologene: 5163
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: D630001M17Rik, LOC381026, 4921513O20Rik, cI-46, 9330188B09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Surf6
Name: surfeit gene 6
Synonyms: D2Wsu129e, Surf-6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20935
Homologene: 133981
Npc1
Name: NPC intracellular cholesterol transporter 1
Synonyms: D18Ertd723e, A430089E03Rik, C85354, D18Ertd139e, lcsd, nmf164
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18145
HGNC: HGNC:7897
Homologene: 228
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: Zfp161, b2b1982Clo, ZF5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22666
Homologene: 2560
Cacna2d3
Name: calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms: alpha 2 delta-3, alpha2delta3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12294
Homologene: 74929
Creld1
Name: cysteine-rich with EGF-like domains 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171508
Homologene: 32265
Aplp2
Name: amyloid beta precursor-like protein 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11804
VEGA: 9
HGNC: HGNC:598
Homologene: 20396
Psmd2
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Synonyms: 9430095H01Rik, Tex190, TEG-190
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21762
HGNC: HGNC:9559
Homologene: 2101
Med23
Name: mediator complex subunit 23
Synonyms: sno, 3000002A17Rik, ESTM7, Crsp3, Sur2, X83317
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Dpys
Name: dihydropyrimidinase
Synonyms: DHPase, 1300004I01Rik, 1200017I10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64705
HGNC: HGNC:3013
Homologene: 20359
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Samd12
Name: sterile alpha motif domain containing 12
Synonyms: A830094I09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320679
Homologene: 35979
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Clec4a2
Name: C-type lectin domain family 4, member a2
Synonyms: Clecsf6, Dcir1, DCIR, dendritic cell immunoreceptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26888
Homologene: 49291
Acat2
Name: acetyl-Coenzyme A acetyltransferase 2
Synonyms: Tcp-1x, Tcp1-rs1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110460
HGNC: HGNC:94
Homologene: 55855
Prlr
Name: prolactin receptor
Synonyms: Pr-1, Prlr-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19116
HGNC: HGNC:9446
Homologene: 733
Col9a2
Name: collagen, type IX, alpha 2
Synonyms: Col9a-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12840
HGNC: HGNC:2218
Homologene: 37535
Vwa3b
Name: von Willebrand factor A domain containing 3B
Synonyms: A230074B11Rik, 4921511C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70853
Homologene: 27053
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Ttll7
Name: tubulin tyrosine ligase-like family, member 7
Synonyms: 4921517B04Rik, 1110049N09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70892
Homologene: 41578
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: C330002I19Rik, 3110039L19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53867
Homologene: 9253
Wdr11
Name: WD repeat domain 11
Synonyms: 2900055P10Rik, Brwd2, Wdr11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207425
Homologene: 41229
Vipr1
Name: vasoactive intestinal peptide receptor 1
Synonyms: VIP-R1, VIP receptor subtype 1, VPAC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22354
Homologene: 3399
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Prkcg
Name: protein kinase C, gamma
Synonyms: Prkcc, PKCgamma, Pkcc
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18752
HGNC: HGNC:9402
Homologene: 20602
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Ros1
Name: Ros1 proto-oncogene
Synonyms: c-ros, Ros-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Caskin1
Name: CASK interacting protein 1
Synonyms: 3300002N10Rik, C630036E02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268932
VEGA: 17
Homologene: 25873
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Pde8a
Name: phosphodiesterase 8A
Synonyms: Pde8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18584
HGNC: HGNC:8793
Homologene: 1957
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 116904
Homologene: 10813
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Axl
Name: AXL receptor tyrosine kinase
Synonyms: Tyro7, Ufo, Ark
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26362
HGNC: HGNC:905
Homologene: 7583
Rab7b
Name: RAB7B, member RAS oncogene family
Synonyms: 5430435G22Rik, Rab7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226421
Homologene: 64833
Dennd2d
Name: DENN domain containing 2D
Synonyms: 2010308M01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72121
Homologene: 11776
Abtb2
Name: ankyrin repeat and BTB domain containing 2
Synonyms: BPOZ-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99382
Homologene: 15904
Klhl33
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Brinp2
Name: bone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms: 6430517E21Rik, Fam5b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240843
Homologene: 10905
Pou2f2
Name: POU domain, class 2, transcription factor 2
Synonyms: Oct2d, Oct2c, Otf2, Oct2b, Oct2a, Oct-2, Otf-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18987
HGNC: HGNC:9213
Homologene: 55674
Fbln5
Name: fibulin 5
Synonyms: EVEC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23876
VEGA: 12
HGNC: HGNC:3602
Homologene: 38170
Tas2r144
Name: taste receptor, type 2, member 144
Synonyms: mt2r33, Tas2r44
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387515
Homologene: 47977
Itgb5
Name: integrin beta 5
Synonyms: [b]5, [b]5B, [b]5A, ESTM23, [b]-5, beta5, beta-5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16419
HGNC: HGNC:6160
Homologene: 20511
Sh3rf3
Name: SH3 domain containing ring finger 3
Synonyms: 4831416G18Rik, Sh3md4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237353
Homologene: 77551
Spata31f3
Name: spermatogenesis associated 31 subfamily F member 3
Synonyms: BC049635, Fam205c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277773
Homologene: 77625
Vmn1r209
Name: vomeronasal 1 receptor 209
Synonyms: Gm11315
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432736
Homologene: 110880
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Or52r1c
Name: olfactory receptor family 52 subfamily R member 1C
Synonyms: Olfr584, GA_x6K02T2PBJ9-5796876-5797820, MOR30-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259056
Zfp78
Name: zinc finger protein 78
Synonyms: KRAB12, Zfp77
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330463
Homologene: 128524
Man2b2
Name: mannosidase 2, alpha B2
Synonyms: 135 kDa alpha-D-mannosidase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17160
Homologene: 7411
Wars2
Name: tryptophanyl tRNA synthetase 2 (mitochondrial)
Synonyms: TrpRS, 9430020O07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70560
Homologene: 5673
Serpina1e
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1E
Synonyms: PI5, Spi1-5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20704
HGNC: HGNC:8941
Homologene: 20103
Atp8b2
Name: ATPase, class I, type 8B, member 2
Synonyms: Id
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54667
Homologene: 23226
Cope
Name: coatomer protein complex, subunit epsilon
Synonyms: Cope1, 1110005D17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 59042
HGNC: HGNC:2234
Homologene: 5254
Polr2l
Name: polymerase (RNA) II (DNA directed) polypeptide L
Synonyms: 2510029B14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66491
HGNC: HGNC:9199
Homologene: 129854
Vmn1r119
Name: vomeronasal 1 receptor 119
Synonyms: LOC384696, Gm1447
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384696
Homologene: 104166
Upp2
Name: uridine phosphorylase 2
Synonyms: UPASE2, 1700124F02Rik, UP2, UDRPASE2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76654
Homologene: 12654
Grap
Name: GRB2-related adaptor protein
Synonyms: 8430435N19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71520
Homologene: 4822
Scgn
Name: secretagogin, EF-hand calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214189
Homologene: 5088
Trim3
Name: tripartite motif-containing 3
Synonyms: BERP1, HAC1, Rnf22
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 55992
Homologene: 21290
Zdhhc16
Name: zinc finger, DHHC domain containing 16
Synonyms: Abl-philin 2, Ablphilin 2, 1500015N03Rik, APH2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74168
VEGA: 19
Homologene: 11377
Fcmr
Name: Fc fragment of IgM receptor
Synonyms: 1810037B05Rik, Faim3, FcmuR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69169
Homologene: 48347
Rbm7
Name: RNA binding motif protein 7
Synonyms: 1500011D06Rik, 1200007M24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67010
VEGA: 9
HGNC: HGNC:9904
Homologene: 9379
Tvp23a
Name: trans-golgi network vesicle protein 23A
Synonyms: Fam18a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 383103
Homologene: 19919
Mri1
Name: methylthioribose-1-phosphate isomerase 1
Synonyms: 2410018C20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67873
Homologene: 7160
Gm16503
Name: predicted gene 16503
Type: Gene
Species: Mouse
Chromosome: 4
Rnf152
Name: ring finger protein 152
Synonyms: A930029B02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320311
Homologene: 18317
Sox18
Name: SRY (sex determining region Y)-box 18
Synonyms: Ragl, Sry-related HMG-box gene 18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20672
Homologene: 7546
Pcdhga10
Name: protocadherin gamma subfamily A, 10
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93722
HGNC: HGNC:8697
Homologene: 49567
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 37,114,534 bp (GRCm38)
  • A to T, chromosome 1 at 105,284,526 bp (GRCm38)
  • A to T, chromosome 1 at 130,874,335 bp (GRCm38)
  • A to T, chromosome 1 at 131,711,802 bp (GRCm38)
  • A to T, chromosome 1 at 158,249,520 bp (GRCm38)
  • T to C, chromosome 2 at 26,892,994 bp (GRCm38)
  • A to G, chromosome 2 at 31,389,347 bp (GRCm38)
  • A to G, chromosome 2 at 58,755,327 bp (GRCm38)
  • A to G, chromosome 2 at 103,717,160 bp (GRCm38)
  • T to C, chromosome 2 at 181,670,438 bp (GRCm38)
  • A to T, chromosome 3 at 89,948,504 bp (GRCm38)
  • T to C, chromosome 3 at 99,187,530 bp (GRCm38)
  • T to A, chromosome 3 at 106,490,414 bp (GRCm38)
  • T to A, chromosome 3 at 146,961,742 bp (GRCm38)
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp (GRCm38)
  • T to A, chromosome 4 at 87,873,931 bp (GRCm38)
  • T to A, chromosome 4 at 121,054,286 bp (GRCm38)
  • T to C, chromosome 4 at 130,316,753 bp (GRCm38)
  • A to T, chromosome 4 at 147,541,051 bp (GRCm38)
  • A to G, chromosome 4 at 148,014,001 bp (GRCm38)
  • A to G, chromosome 5 at 36,818,607 bp (GRCm38)
  • A to T, chromosome 5 at 43,718,657 bp (GRCm38)
  • A to G, chromosome 5 at 76,916,037 bp (GRCm38)
  • T to C, chromosome 5 at 120,540,672 bp (GRCm38)
  • A to G, chromosome 5 at 150,780,721 bp (GRCm38)
  • T to A, chromosome 6 at 11,961,564 bp (GRCm38)
  • A to T, chromosome 6 at 42,216,132 bp (GRCm38)
  • A to G, chromosome 6 at 92,243,842 bp (GRCm38)
  • C to T, chromosome 6 at 113,489,767 bp (GRCm38)
  • G to T, chromosome 6 at 123,127,996 bp (GRCm38)
  • T to A, chromosome 7 at 3,310,608 bp (GRCm38)
  • T to C, chromosome 7 at 6,378,943 bp (GRCm38)
  • T to C, chromosome 7 at 16,839,902 bp (GRCm38)
  • A to G, chromosome 7 at 21,012,433 bp (GRCm38)
  • G to A, chromosome 7 at 25,094,852 bp (GRCm38)
  • A to T, chromosome 7 at 25,774,119 bp (GRCm38)
  • A to G, chromosome 7 at 81,092,331 bp (GRCm38)
  • A to T, chromosome 7 at 81,300,679 bp (GRCm38)
  • A to T, chromosome 7 at 103,086,117 bp (GRCm38)
  • A to G, chromosome 7 at 105,611,466 bp (GRCm38)
  • T to C, chromosome 7 at 129,630,799 bp (GRCm38)
  • A to G, chromosome 7 at 141,473,333 bp (GRCm38)
  • G to A, chromosome 8 at 15,084,633 bp (GRCm38)
  • A to G, chromosome 8 at 66,704,099 bp (GRCm38)
  • T to C, chromosome 8 at 70,308,578 bp (GRCm38)
  • A to T, chromosome 8 at 84,257,167 bp (GRCm38)
  • T to C, chromosome 9 at 20,793,613 bp (GRCm38)
  • A to T, chromosome 9 at 31,211,639 bp (GRCm38)
  • T to C, chromosome 9 at 48,489,669 bp (GRCm38)
  • C to T, chromosome 9 at 67,323,071 bp (GRCm38)
  • T to C, chromosome 9 at 108,115,502 bp (GRCm38)
  • G to A, chromosome 9 at 121,642,927 bp (GRCm38)
  • T to A, chromosome 10 at 24,912,807 bp (GRCm38)
  • A to G, chromosome 10 at 52,096,020 bp (GRCm38)
  • A to G, chromosome 10 at 59,130,980 bp (GRCm38)
  • T to G, chromosome 10 at 116,510,421 bp (GRCm38)
  • T to C, chromosome 11 at 8,836,399 bp (GRCm38)
  • T to A, chromosome 11 at 8,961,305 bp (GRCm38)
  • C to A, chromosome 11 at 61,671,725 bp (GRCm38)
  • A to G, chromosome 12 at 25,008,079 bp (GRCm38)
  • G to A, chromosome 12 at 101,771,292 bp (GRCm38)
  • T to A, chromosome 12 at 103,951,040 bp (GRCm38)
  • T to A, chromosome 13 at 22,806,376 bp (GRCm38)
  • T to A, chromosome 13 at 23,989,846 bp (GRCm38)
  • G to T, chromosome 13 at 51,419,517 bp (GRCm38)
  • A to T, chromosome 14 at 28,982,358 bp (GRCm38)
  • A to G, chromosome 14 at 50,896,446 bp (GRCm38)
  • A to G, chromosome 14 at 61,208,770 bp (GRCm38)
  • A to G, chromosome 14 at 72,480,060 bp (GRCm38)
  • T to A, chromosome 15 at 9,713,104 bp (GRCm38)
  • A to G, chromosome 15 at 10,328,902 bp (GRCm38)
  • T to C, chromosome 15 at 39,793,352 bp (GRCm38)
  • G to A, chromosome 15 at 48,151,605 bp (GRCm38)
  • A to G, chromosome 15 at 53,719,692 bp (GRCm38)
  • A to T, chromosome 15 at 78,287,087 bp (GRCm38)
  • A to G, chromosome 15 at 91,700,415 bp (GRCm38)
  • T to C, chromosome 15 at 97,979,894 bp (GRCm38)
  • G to A, chromosome 15 at 99,279,735 bp (GRCm38)
  • T to C, chromosome 16 at 10,427,423 bp (GRCm38)
  • T to C, chromosome 16 at 13,400,927 bp (GRCm38)
  • T to C, chromosome 16 at 20,656,691 bp (GRCm38)
  • A to T, chromosome 16 at 32,751,153 bp (GRCm38)
  • T to A, chromosome 16 at 33,910,456 bp (GRCm38)
  • T to C, chromosome 17 at 12,948,651 bp (GRCm38)
  • A to G, chromosome 17 at 24,504,473 bp (GRCm38)
  • T to C, chromosome 17 at 30,998,727 bp (GRCm38)
  • A to G, chromosome 17 at 69,388,581 bp (GRCm38)
  • A to G, chromosome 18 at 12,201,712 bp (GRCm38)
  • G to T, chromosome 18 at 37,747,479 bp (GRCm38)
  • G to A, chromosome 19 at 6,314,523 bp (GRCm38)
  • T to A, chromosome 19 at 41,627,298 bp (GRCm38)
  • T to C, chromosome 19 at 41,938,110 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9343 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069154-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.