Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9343Btlr/Mmmh
Stock Number:
069154-MU
Citation ID:
RRID:MMRRC_069154-MU
Other Names:
R9343 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Y1-R, Npyr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Pds5b
Name: PDS5 cohesin associated factor B
Synonyms: AS3, Aprin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100710
Homologene: 41001
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 37,114,534 bp (GRCm38)
  • A to T, chromosome 1 at 105,284,526 bp (GRCm38)
  • A to T, chromosome 1 at 130,874,335 bp (GRCm38)
  • A to T, chromosome 1 at 131,711,802 bp (GRCm38)
  • A to T, chromosome 1 at 158,249,520 bp (GRCm38)
  • T to C, chromosome 2 at 26,892,994 bp (GRCm38)
  • A to G, chromosome 2 at 31,389,347 bp (GRCm38)
  • A to G, chromosome 2 at 58,755,327 bp (GRCm38)
  • A to G, chromosome 2 at 103,717,160 bp (GRCm38)
  • T to C, chromosome 2 at 181,670,438 bp (GRCm38)
  • A to T, chromosome 3 at 89,948,504 bp (GRCm38)
  • T to C, chromosome 3 at 99,187,530 bp (GRCm38)
  • T to A, chromosome 3 at 106,490,414 bp (GRCm38)
  • T to A, chromosome 3 at 146,961,742 bp (GRCm38)
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp (GRCm38)
  • T to A, chromosome 4 at 87,873,931 bp (GRCm38)
  • T to A, chromosome 4 at 121,054,286 bp (GRCm38)
  • T to C, chromosome 4 at 130,316,753 bp (GRCm38)
  • A to T, chromosome 4 at 147,541,051 bp (GRCm38)
  • A to G, chromosome 4 at 148,014,001 bp (GRCm38)
  • A to G, chromosome 5 at 36,818,607 bp (GRCm38)
  • A to T, chromosome 5 at 43,718,657 bp (GRCm38)
  • A to G, chromosome 5 at 76,916,037 bp (GRCm38)
  • T to C, chromosome 5 at 120,540,672 bp (GRCm38)
  • A to G, chromosome 5 at 150,780,721 bp (GRCm38)
  • T to A, chromosome 6 at 11,961,564 bp (GRCm38)
  • A to T, chromosome 6 at 42,216,132 bp (GRCm38)
  • A to G, chromosome 6 at 92,243,842 bp (GRCm38)
  • C to T, chromosome 6 at 113,489,767 bp (GRCm38)
  • G to T, chromosome 6 at 123,127,996 bp (GRCm38)
  • T to A, chromosome 7 at 3,310,608 bp (GRCm38)
  • T to C, chromosome 7 at 6,378,943 bp (GRCm38)
  • T to C, chromosome 7 at 16,839,902 bp (GRCm38)
  • A to G, chromosome 7 at 21,012,433 bp (GRCm38)
  • G to A, chromosome 7 at 25,094,852 bp (GRCm38)
  • A to T, chromosome 7 at 25,774,119 bp (GRCm38)
  • A to G, chromosome 7 at 81,092,331 bp (GRCm38)
  • A to T, chromosome 7 at 81,300,679 bp (GRCm38)
  • A to T, chromosome 7 at 103,086,117 bp (GRCm38)
  • A to G, chromosome 7 at 105,611,466 bp (GRCm38)
  • T to C, chromosome 7 at 129,630,799 bp (GRCm38)
  • A to G, chromosome 7 at 141,473,333 bp (GRCm38)
  • G to A, chromosome 8 at 15,084,633 bp (GRCm38)
  • A to G, chromosome 8 at 66,704,099 bp (GRCm38)
  • T to C, chromosome 8 at 70,308,578 bp (GRCm38)
  • A to T, chromosome 8 at 84,257,167 bp (GRCm38)
  • T to C, chromosome 9 at 20,793,613 bp (GRCm38)
  • A to T, chromosome 9 at 31,211,639 bp (GRCm38)
  • T to C, chromosome 9 at 48,489,669 bp (GRCm38)
  • C to T, chromosome 9 at 67,323,071 bp (GRCm38)
  • T to C, chromosome 9 at 108,115,502 bp (GRCm38)
  • G to A, chromosome 9 at 121,642,927 bp (GRCm38)
  • T to A, chromosome 10 at 24,912,807 bp (GRCm38)
  • A to G, chromosome 10 at 52,096,020 bp (GRCm38)
  • A to G, chromosome 10 at 59,130,980 bp (GRCm38)
  • T to G, chromosome 10 at 116,510,421 bp (GRCm38)
  • T to C, chromosome 11 at 8,836,399 bp (GRCm38)
  • T to A, chromosome 11 at 8,961,305 bp (GRCm38)
  • C to A, chromosome 11 at 61,671,725 bp (GRCm38)
  • A to G, chromosome 12 at 25,008,079 bp (GRCm38)
  • G to A, chromosome 12 at 101,771,292 bp (GRCm38)
  • T to A, chromosome 12 at 103,951,040 bp (GRCm38)
  • T to A, chromosome 13 at 22,806,376 bp (GRCm38)
  • T to A, chromosome 13 at 23,989,846 bp (GRCm38)
  • G to T, chromosome 13 at 51,419,517 bp (GRCm38)
  • A to T, chromosome 14 at 28,982,358 bp (GRCm38)
  • A to G, chromosome 14 at 50,896,446 bp (GRCm38)
  • A to G, chromosome 14 at 61,208,770 bp (GRCm38)
  • A to G, chromosome 14 at 72,480,060 bp (GRCm38)
  • T to A, chromosome 15 at 9,713,104 bp (GRCm38)
  • A to G, chromosome 15 at 10,328,902 bp (GRCm38)
  • T to C, chromosome 15 at 39,793,352 bp (GRCm38)
  • G to A, chromosome 15 at 48,151,605 bp (GRCm38)
  • A to G, chromosome 15 at 53,719,692 bp (GRCm38)
  • A to T, chromosome 15 at 78,287,087 bp (GRCm38)
  • A to G, chromosome 15 at 91,700,415 bp (GRCm38)
  • T to C, chromosome 15 at 97,979,894 bp (GRCm38)
  • G to A, chromosome 15 at 99,279,735 bp (GRCm38)
  • T to C, chromosome 16 at 10,427,423 bp (GRCm38)
  • T to C, chromosome 16 at 13,400,927 bp (GRCm38)
  • T to C, chromosome 16 at 20,656,691 bp (GRCm38)
  • A to T, chromosome 16 at 32,751,153 bp (GRCm38)
  • T to A, chromosome 16 at 33,910,456 bp (GRCm38)
  • T to C, chromosome 17 at 12,948,651 bp (GRCm38)
  • A to G, chromosome 17 at 24,504,473 bp (GRCm38)
  • T to C, chromosome 17 at 30,998,727 bp (GRCm38)
  • A to G, chromosome 17 at 69,388,581 bp (GRCm38)
  • A to G, chromosome 18 at 12,201,712 bp (GRCm38)
  • G to T, chromosome 18 at 37,747,479 bp (GRCm38)
  • G to A, chromosome 19 at 6,314,523 bp (GRCm38)
  • T to A, chromosome 19 at 41,627,298 bp (GRCm38)
  • T to C, chromosome 19 at 41,938,110 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9343 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069154-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.