Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9356Btlr/Mmmh
Stock Number:
069165-MU
Citation ID:
RRID:MMRRC_069165-MU
Other Names:
R9356 (G1)
Major Collection:

Strain Information

Chrna7
Name: cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms: Acra7, alpha7, alpha7 nicotinic receptor, alpha7-nAChR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11441
Homologene: 593
Arrdc4
Name: arrestin domain containing 4
Synonyms: 2410003C09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66412
Homologene: 41636
Mdm4
Name: MDM4 regulator of p53
Synonyms: Mdmx, 4933417N07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17248
HGNC: HGNC:6974
Homologene: 1794
Uba3
Name: ubiquitin-like modifier activating enzyme 3
Synonyms: ubiquitin activating enzyme 3, A830034N06Rik, Ube1c
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22200
Homologene: 2951
Rxra
Name: retinoid X receptor alpha
Synonyms: RXRalpha1, RXR alpha 1, 9530071D11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20181
Homologene: 2220
Ythdf1
Name: YTH N6-methyladenosine RNA binding protein 1
Synonyms: 2210410K23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228994
Homologene: 9844
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 36,428,334 bp (GRCm38)
  • G to A, chromosome 1 at 133,011,099 bp (GRCm38)
  • A to T, chromosome 1 at 135,972,087 bp (GRCm38)
  • T to A, chromosome 2 at 27,759,663 bp (GRCm38)
  • T to A, chromosome 2 at 86,890,261 bp (GRCm38)
  • T to A, chromosome 2 at 87,737,745 bp (GRCm38)
  • T to C, chromosome 2 at 114,196,436 bp (GRCm38)
  • A to C, chromosome 2 at 180,912,205 bp (GRCm38)
  • A to T, chromosome 3 at 38,456,087 bp (GRCm38)
  • TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT to TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT, chromosome 3 at 92,718,965 bp (GRCm38)
  • C to T, chromosome 3 at 95,295,279 bp (GRCm38)
  • A to C, chromosome 3 at 95,546,809 bp (GRCm38)
  • T to A, chromosome 3 at 96,706,372 bp (GRCm38)
  • C to A, chromosome 4 at 115,328,718 bp (GRCm38)
  • A to T, chromosome 4 at 126,370,351 bp (GRCm38)
  • G to T, chromosome 4 at 147,613,901 bp (GRCm38)
  • C to A, chromosome 5 at 34,636,704 bp (GRCm38)
  • A to G, chromosome 5 at 92,605,418 bp (GRCm38)
  • T to A, chromosome 5 at 117,689,641 bp (GRCm38)
  • C to T, chromosome 5 at 120,459,883 bp (GRCm38)
  • A to G, chromosome 5 at 135,210,799 bp (GRCm38)
  • T to C, chromosome 5 at 136,968,114 bp (GRCm38)
  • T to C, chromosome 6 at 3,687,408 bp (GRCm38)
  • T to A, chromosome 6 at 24,800,566 bp (GRCm38)
  • T to C, chromosome 6 at 97,184,850 bp (GRCm38)
  • T to C, chromosome 6 at 124,861,334 bp (GRCm38)
  • A to G, chromosome 7 at 45,793,888 bp (GRCm38)
  • A to T, chromosome 7 at 63,107,689 bp (GRCm38)
  • A to T, chromosome 7 at 64,695,673 bp (GRCm38)
  • A to G, chromosome 7 at 68,744,879 bp (GRCm38)
  • T to A, chromosome 7 at 98,076,666 bp (GRCm38)
  • A to G, chromosome 7 at 104,939,166 bp (GRCm38)
  • T to C, chromosome 7 at 127,946,525 bp (GRCm38)
  • A to G, chromosome 8 at 9,972,538 bp (GRCm38)
  • A to T, chromosome 8 at 16,202,055 bp (GRCm38)
  • A to G, chromosome 8 at 46,590,283 bp (GRCm38)
  • T to A, chromosome 10 at 27,212,190 bp (GRCm38)
  • T to C, chromosome 10 at 82,289,323 bp (GRCm38)
  • T to C, chromosome 10 at 107,782,029 bp (GRCm38)
  • T to G, chromosome 10 at 129,768,166 bp (GRCm38)
  • G to A, chromosome 11 at 9,256,305 bp (GRCm38)
  • T to A, chromosome 11 at 59,454,935 bp (GRCm38)
  • G to A, chromosome 11 at 99,583,343 bp (GRCm38)
  • T to C, chromosome 11 at 102,402,064 bp (GRCm38)
  • T to G, chromosome 14 at 33,630,908 bp (GRCm38)
  • T to C, chromosome 14 at 65,032,321 bp (GRCm38)
  • T to C, chromosome 15 at 74,610,911 bp (GRCm38)
  • C to T, chromosome 16 at 91,495,479 bp (GRCm38)
  • A to G, chromosome 17 at 64,311,209 bp (GRCm38)
  • T to A, chromosome 18 at 12,720,045 bp (GRCm38)
  • C to A, chromosome 18 at 31,977,043 bp (GRCm38)
  • C to T, chromosome 18 at 33,464,322 bp (GRCm38)
  • A to C, chromosome 18 at 78,184,608 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9356 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069165-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.