Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9359Btlr/Mmmh
Stock Number:
069168-MU
Citation ID:
RRID:MMRRC_069168-MU
Other Names:
R9359 (G1)
Major Collection:

Strain Information

Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Txndc2
Name: thioredoxin domain containing 2 (spermatozoa)
Synonyms: Sptrx-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213272
VEGA: 17
Homologene: 41856
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: Zntl1, ZnT-5, ZTL1, 1810010K08Rik, Znt5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Gabbr1
Name: gamma-aminobutyric acid type B receptor subunit 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 9,745,824 bp (GRCm38)
  • T to C, chromosome 1 at 37,995,778 bp (GRCm38)
  • A to T, chromosome 1 at 97,062,523 bp (GRCm38)
  • A to G, chromosome 1 at 155,782,597 bp (GRCm38)
  • T to C, chromosome 2 at 15,614,177 bp (GRCm38)
  • T to A, chromosome 2 at 79,325,660 bp (GRCm38)
  • C to T, chromosome 2 at 151,938,972 bp (GRCm38)
  • A to T, chromosome 3 at 38,483,023 bp (GRCm38)
  • T to C, chromosome 3 at 105,986,567 bp (GRCm38)
  • T to C, chromosome 4 at 96,061,933 bp (GRCm38)
  • A to G, chromosome 5 at 9,121,927 bp (GRCm38)
  • G to A, chromosome 5 at 149,209,671 bp (GRCm38)
  • T to A, chromosome 6 at 8,214,894 bp (GRCm38)
  • G to A, chromosome 6 at 38,082,113 bp (GRCm38)
  • T to C, chromosome 7 at 135,168,396 bp (GRCm38)
  • G to C, chromosome 8 at 3,158,717 bp (GRCm38)
  • A to G, chromosome 8 at 11,512,968 bp (GRCm38)
  • T to A, chromosome 8 at 65,014,576 bp (GRCm38)
  • C to T, chromosome 8 at 111,187,793 bp (GRCm38)
  • A to T, chromosome 8 at 123,458,366 bp (GRCm38)
  • C to T, chromosome 9 at 13,621,673 bp (GRCm38)
  • A to G, chromosome 9 at 18,537,764 bp (GRCm38)
  • C to A, chromosome 9 at 123,052,772 bp (GRCm38)
  • C to T, chromosome 10 at 6,890,663 bp (GRCm38)
  • A to T, chromosome 10 at 80,381,747 bp (GRCm38)
  • A to G, chromosome 10 at 81,333,124 bp (GRCm38)
  • A to G, chromosome 10 at 84,905,057 bp (GRCm38)
  • A to G, chromosome 11 at 21,292,108 bp (GRCm38)
  • T to C, chromosome 11 at 71,759,973 bp (GRCm38)
  • TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,100,036 bp (GRCm38)
  • A to G, chromosome 13 at 16,017,381 bp (GRCm38)
  • T to C, chromosome 13 at 21,133,695 bp (GRCm38)
  • G to A, chromosome 13 at 24,979,729 bp (GRCm38)
  • T to A, chromosome 13 at 48,586,554 bp (GRCm38)
  • T to C, chromosome 13 at 100,813,462 bp (GRCm38)
  • A to G, chromosome 14 at 44,853,258 bp (GRCm38)
  • T to C, chromosome 14 at 49,929,449 bp (GRCm38)
  • C to T, chromosome 16 at 91,495,479 bp (GRCm38)
  • G to T, chromosome 17 at 7,374,443 bp (GRCm38)
  • A to G, chromosome 17 at 23,668,849 bp (GRCm38)
  • C to T, chromosome 17 at 31,603,255 bp (GRCm38)
  • A to G, chromosome 17 at 37,070,713 bp (GRCm38)
  • A to T, chromosome 17 at 54,276,641 bp (GRCm38)
  • G to A, chromosome 17 at 65,637,997 bp (GRCm38)
  • C to T, chromosome 18 at 33,464,322 bp (GRCm38)
  • T to A, chromosome 19 at 12,333,439 bp (GRCm38)
  • C to T, chromosome 19 at 13,794,836 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9359 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069168-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.