Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9359Btlr/Mmmh
Stock Number:
069168-MU
Citation ID:
RRID:MMRRC_069168-MU
Other Names:
R9359 (G1)
Major Collection:

Strain Information

Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Txndc2
Name: thioredoxin domain containing 2 (spermatozoa)
Synonyms: Sptrx-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213272
VEGA: 17
Homologene: 41856
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: Zntl1, ZnT-5, ZTL1, 1810010K08Rik, Znt5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Gabbr1
Name: gamma-aminobutyric acid type B receptor subunit 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Ifnar1
Name: interferon (alpha and beta) receptor 1
Synonyms: Ifrc, Ifar, IFN-alpha/betaR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15975
HGNC: HGNC:5432
Homologene: 524
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Glg1
Name: golgi apparatus protein 1
Synonyms: ESL-1, CFR, MG-160, MG160, CFR-1, Selel
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Def8
Name: differentially expressed in FDCP 8
Synonyms: D8Ertd713e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23854
Homologene: 14279
Naxd
Name: NAD(P)HX dehydratase
Synonyms: 2810407E01Rik, 0710008K08Rik, Carkd
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69225
Homologene: 6333
Thoc6
Name: THO complex 6
Synonyms: F830014G06Rik, Wdr58
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 386612
Homologene: 11533
Wscd1
Name: WSC domain containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216881
Homologene: 18590
Maml2
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270118
Homologene: 134147
Atp6v0a4
Name: ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms: V-ATPase alpha 4, Atp6n1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140494
HGNC: HGNC:866
Homologene: 39904
Itga4
Name: integrin alpha 4
Synonyms: VLA-4 receptor, alpha 4 subunit
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16401
HGNC: HGNC:6140
Homologene: 37364
Ipcef1
Name: interaction protein for cytohesin exchange factors 1
Synonyms: A130090K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320495
Homologene: 32271
Ptpdc1
Name: protein tyrosine phosphatase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218232
VEGA: 13
Homologene: 17576
Gpld1
Name: glycosylphosphatidylinositol specific phospholipase D1
Synonyms: 6330541J12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14756
HGNC: HGNC:4459
Homologene: 1152
Uspl1
Name: ubiquitin specific peptidase like 1
Synonyms: E430026A01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231915
Homologene: 4235
Inhba
Name: inhibin beta-A
Synonyms: activin beta-A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16323
VEGA: 13
HGNC: HGNC:6066
Homologene: 1653
Insr
Name: insulin receptor
Synonyms: IR, CD220, 4932439J01Rik, D630014A15Rik, IR-B, IR-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Ankrd50
Name: ankyrin repeat domain 50
Synonyms: E430012K20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99696
Homologene: 129859
Slco6c1
Name: solute carrier organic anion transporter family, member 6c1
Synonyms: 4933404A18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74441
Homologene: 65259
Rfx4
Name: regulatory factor X, 4 (influences HLA class II expression)
Synonyms: 4933412G19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71137
HGNC: HGNC:9985
Homologene: 31119
Or9q2
Name: olfactory receptor family 9 subfamily Q member 2
Synonyms: GA_x6K02T2RE5P-4127765-4126821, MOR212-1, Olfr1497
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258736
Homologene: 17373
Trim61
Name: tripartite motif-containing 61
Synonyms: 2czf61, E330039K03Rik, Rnf35
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 260296
Tbxa2r
Name: thromboxane A2 receptor
Synonyms: TP, Tp receptor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21390
VEGA: 10
Homologene: 825
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: 5730421J18Rik, 5730538E15Rik, Vcip135
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70675
Homologene: 11814
Ovgp1
Name: oviductal glycoprotein 1
Synonyms: MOGP, muc9, mucin 9, oviductin, Chit5, OGP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12659
HGNC: HGNC:8524
Homologene: 74442
Slc5a7
Name: solute carrier family 5 (choline transporter), member 7
Synonyms: CHT1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63993
VEGA: 17
Homologene: 32516
Mex3d
Name: mex3 RNA binding family member D
Synonyms: Rkhd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237400
Homologene: 16890
Tgm4
Name: transglutaminase 4 (prostate)
Synonyms: experimental autoimmune prostatitis antigen 1, Eapa1, 9530008N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331046
Homologene: 20689
Gm10549
Name: predicted gene 10549
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 433171
VEGA: 18
Mios
Name: meiosis regulator for oocyte development
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 252875
Homologene: 10371
Cyp2j13
Name: cytochrome P450, family 2, subfamily j, polypeptide 13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230459
HGNC: HGNC:2634
Homologene: 138297
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: 2410154J16Rik, Ndp52l1, Ndp52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Unc93a2
Name: unc-93 homolog A2
Synonyms: Gm9992
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 667055
VEGA: 17
Homologene: 10356
Ptgdr
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19214
HGNC: HGNC:9591
Homologene: 736
Or4l1
Name: olfactory receptor family 4 subfamily L member 1
Synonyms: GA_x6K02T2PMLR-5600424-5599495, MOR247-3P, MOR247-4, Olfr723
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 259147
Homologene: 71986
Qsox1
Name: quiescin Q6 sulfhydryl oxidase 1
Synonyms: 1300003H02Rik, Qscn6, QSOX, b2b2673Clo
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 104009
HGNC: HGNC:9756
Homologene: 37690
Txndc9
Name: thioredoxin domain containing 9
Synonyms: ATP binding protein associated with cell differentiation, Apacd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98258
Homologene: 4225
Or2w1
Name: olfactory receptor family 2 subfamily W member 1
Synonyms: IA3, GA_x6K02T2N5E5-9379-8514, MOR256-31, GA_x6K02T2QHY8-12114828-12113875, MOR256-37P, MOR256-61, Olfr42, Olfr263-ps1, Olfr263
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18341
HGNC: HGNC:8281
Homologene: 12791
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Or5a21
Name: olfactory receptor family 5 subfamily A member 21
Synonyms: GA_x6K02T2RE5P-2669245-2668277, MOR215-4, Olfr1438
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258116
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 9,745,824 bp (GRCm38)
  • T to C, chromosome 1 at 37,995,778 bp (GRCm38)
  • A to T, chromosome 1 at 97,062,523 bp (GRCm38)
  • A to G, chromosome 1 at 155,782,597 bp (GRCm38)
  • T to C, chromosome 2 at 15,614,177 bp (GRCm38)
  • T to A, chromosome 2 at 79,325,660 bp (GRCm38)
  • C to T, chromosome 2 at 151,938,972 bp (GRCm38)
  • A to T, chromosome 3 at 38,483,023 bp (GRCm38)
  • T to C, chromosome 3 at 105,986,567 bp (GRCm38)
  • T to C, chromosome 4 at 96,061,933 bp (GRCm38)
  • A to G, chromosome 5 at 9,121,927 bp (GRCm38)
  • G to A, chromosome 5 at 149,209,671 bp (GRCm38)
  • T to A, chromosome 6 at 8,214,894 bp (GRCm38)
  • G to A, chromosome 6 at 38,082,113 bp (GRCm38)
  • T to C, chromosome 7 at 135,168,396 bp (GRCm38)
  • G to C, chromosome 8 at 3,158,717 bp (GRCm38)
  • A to G, chromosome 8 at 11,512,968 bp (GRCm38)
  • T to A, chromosome 8 at 65,014,576 bp (GRCm38)
  • C to T, chromosome 8 at 111,187,793 bp (GRCm38)
  • A to T, chromosome 8 at 123,458,366 bp (GRCm38)
  • C to T, chromosome 9 at 13,621,673 bp (GRCm38)
  • A to G, chromosome 9 at 18,537,764 bp (GRCm38)
  • C to A, chromosome 9 at 123,052,772 bp (GRCm38)
  • C to T, chromosome 10 at 6,890,663 bp (GRCm38)
  • A to T, chromosome 10 at 80,381,747 bp (GRCm38)
  • A to G, chromosome 10 at 81,333,124 bp (GRCm38)
  • A to G, chromosome 10 at 84,905,057 bp (GRCm38)
  • A to G, chromosome 11 at 21,292,108 bp (GRCm38)
  • T to C, chromosome 11 at 71,759,973 bp (GRCm38)
  • TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,100,036 bp (GRCm38)
  • A to G, chromosome 13 at 16,017,381 bp (GRCm38)
  • T to C, chromosome 13 at 21,133,695 bp (GRCm38)
  • G to A, chromosome 13 at 24,979,729 bp (GRCm38)
  • T to A, chromosome 13 at 48,586,554 bp (GRCm38)
  • T to C, chromosome 13 at 100,813,462 bp (GRCm38)
  • A to G, chromosome 14 at 44,853,258 bp (GRCm38)
  • T to C, chromosome 14 at 49,929,449 bp (GRCm38)
  • C to T, chromosome 16 at 91,495,479 bp (GRCm38)
  • G to T, chromosome 17 at 7,374,443 bp (GRCm38)
  • A to G, chromosome 17 at 23,668,849 bp (GRCm38)
  • C to T, chromosome 17 at 31,603,255 bp (GRCm38)
  • A to G, chromosome 17 at 37,070,713 bp (GRCm38)
  • A to T, chromosome 17 at 54,276,641 bp (GRCm38)
  • G to A, chromosome 17 at 65,637,997 bp (GRCm38)
  • C to T, chromosome 18 at 33,464,322 bp (GRCm38)
  • T to A, chromosome 19 at 12,333,439 bp (GRCm38)
  • C to T, chromosome 19 at 13,794,836 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9359 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069168-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.