Strain Name:
C57BL/6J-MtgxR9364Btlr/Mmmh
Stock Number:
069173-MU
Citation ID:
RRID:MMRRC_069173-MU
Other Names:
R9364 (G1)
Major Collection:

Strain Information

Neurod4
Name: neurogenic differentiation 4
Synonyms: MATH-3, Math3, Atoh3, bHLHa4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11923
VEGA: 10
Homologene: 7234
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2a, trp2, TRPC2b, 3010009O07Rik, Trrp2, mTrp2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22064
Homologene: 135989
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: Nav1.3, LOC381367
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Zfp809
Name: zinc finger protein 809
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235047
VEGA: 9
Fgd4
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-gamma, Frabin-beta, Frabin-alpha, Frabin, 9330209B17Rik, ZFYVE6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224014
Homologene: 26727
Emb
Name: embigin
Synonyms: Gp70
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13723
Homologene: 7743
Zfp7
Name: zinc finger protein 7
Synonyms: KRAB20, KRAB7, Zfp65, mszf73-2, Krox-2, Zfp-7, Zfp80, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Dusp16
Name: dual specificity phosphatase 16
Synonyms: MKP-7, MKP7, 3830417M17Rik, D6Ertd213e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70686
Homologene: 15604
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Depdc5
Name: DEP domain containing 5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 277854
Homologene: 34718
Tyw1
Name: tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms: Rsafd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100929
Homologene: 7068
Nfx1
Name: nuclear transcription factor, X-box binding 1
Synonyms: TEG-42, 1300017N15Rik, 3000003M19Rik, Tex42
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74164
HGNC: HGNC:7803
Homologene: 1875
Myo9b
Name: myosin IXb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17925
HGNC: HGNC:7609
Homologene: 3058
Pid1
Name: phosphotyrosine interaction domain containing 1
Synonyms: 5033414K04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98496
Homologene: 9924
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Ccnyl1
Name: cyclin Y-like 1
Synonyms: 9630037P07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227210
Homologene: 65050
Ubn1
Name: ubinuclein 1
Synonyms: 1110029L11Rik, 2610108L02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 170644
VEGA: 16
Homologene: 9656
Uchl1
Name: ubiquitin carboxy-terminal hydrolase L1
Synonyms: PGP9.5, PGP 9.5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22223
Homologene: 37894
Klf13
Name: Kruppel-like transcription factor 13
Synonyms: FKLF-2, NSLP1, RFLAT1, Klf13, RFLAT-1, Bteb3, 9430029L20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50794
Homologene: 32288
Ntng1
Name: netrin G1
Synonyms: Lmnt1, A930010C08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80883
Homologene: 8949
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Lrrc47
Name: leucine rich repeat containing 47
Synonyms: 2900010D03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72946
Homologene: 10795
Dnajc18
Name: DnaJ heat shock protein family (Hsp40) member C18
Synonyms: 2700075B01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76594
VEGA: 18
Homologene: 23692
Ccn4
Name: cellular communication network factor 4
Synonyms: Elm1, CCN4, Wisp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22402
Homologene: 2883
Tarbp1
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212728
Homologene: 38082
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Oc90
Name: otoconin 90
Synonyms: PLA2L, Ocn-95, Pla2ll
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18256
HGNC: HGNC:8100
Homologene: 19021
Zfp429
Name: zinc finger protein 429
Synonyms: 2810487A22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72807
Homologene: 110878
Pdzd8
Name: PDZ domain containing 8
Synonyms: A630041P07Rik, Pdzk8
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Slx4
Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms: D16Bwg1016e, Btbd12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52864
Homologene: 23770
Myo7b
Name: myosin VIIB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17922
HGNC: HGNC:7607
Homologene: 81947
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Prpsap1
Name: phosphoribosyl pyrophosphate synthetase-associated protein 1
Synonyms: PAP39, 5730409F23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67763
HGNC: HGNC:9466
Homologene: 55687
Or2aj4
Name: olfactory receptor family 2 subfamily AJ member 4
Synonyms: GA_x54KRFPKG5P-16014972-16014031, MOR273-3P, Olfr169
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258158
Homologene: 128058
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Sh2d4a
Name: SH2 domain containing 4A
Synonyms: 2210402M20Rik, SH2A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72281
Homologene: 11117
Ms4a4a
Name: membrane-spanning 4-domains, subfamily A, member 4A
Synonyms: EG666907
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 666907
Homologene: 103874
Fam120b
Name: family with sequence similarity 120, member B
Synonyms: CCPG, 4932442K08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67544
VEGA: 17
Homologene: 13033
Vmn1r193
Name: vomeronasal 1 receptor 193
Synonyms: V1ri9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171259
Homologene: 110880
Cyp17a1
Name: cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms: p450c17, Cyp17, steroid 17-alpha hydroxylase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13074
HGNC: HGNC:2593
Homologene: 73875
Efcab12
Name: EF-hand calcium binding domain 12
Synonyms: BC060267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 212516
Homologene: 18905
Or1x6
Name: olfactory receptor family 1 subfamily X member 6
Synonyms: GA_x6K02T2QP88-4389999-4389056, MOR126-2, Olfr1375-ps1, Olfr1375
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258509
Zfp618
Name: zinc finger protein 618
Synonyms: Nedd10, 2810040O04Rik, 2810031P15Rik, D430033D05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72701
Homologene: 18975
Ddx49
Name: DEAD box helicase 49
Synonyms: R27090_2, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234374
Homologene: 41308
Sh2b2
Name: SH2B adaptor protein 2
Synonyms: Aps
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23921
Homologene: 10309
Opcml
Name: opioid binding protein/cell adhesion molecule-like
Synonyms: Obcam, LOC235104, 2900075O15Rik, B930023M13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330908
HGNC: HGNC:8143
Homologene: 55663
Skint9
Name: selection and upkeep of intraepithelial T cells 9
Synonyms: A030013N09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329918
Homologene: 136292
Ccdc136
Name: coiled-coil domain containing 136
Synonyms: 4921511K06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232664
Homologene: 23378
Slc5a11
Name: solute carrier family 5 (sodium/glucose cotransporter), member 11
Synonyms: 2010013B02Rik, Kst1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233836
Homologene: 14184
Zfp78
Name: zinc finger protein 78
Synonyms: KRAB12, Zfp77
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330463
Homologene: 128524
Mtcl3
Name: MTCL family member 3
Synonyms: 6330407J23Rik, Soga3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67412
VEGA: 10
Homologene: 28227
Med22
Name: mediator complex subunit 22
Synonyms: Surf-5, Surf5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20933
Homologene: 4913
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Trim72
Name: tripartite motif-containing 72
Synonyms: mitsugumin 53, MG53
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434246
Homologene: 66924
Mmel1
Name: membrane metallo-endopeptidase-like 1
Synonyms: Nl1, NEPLP gamma, NEPLP beta, NEPLP alpha, SEP, Mell1, Nep2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27390
Homologene: 22778
R3hdml
Name: R3H domain containing-like
Synonyms: OTTMUSG00000001070
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100043899
Homologene: 45608
Or8k3b
Name: olfactory receptor family 8 subfamily K member 3B
Synonyms: GA_x6K02T2Q125-48182406-48181465, MOR188-5, Olfr1087
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258843
Mettl15
Name: methyltransferase like 15
Synonyms: 0610027B03Rik, Mett5d1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76894
Homologene: 12661
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Or2a12
Name: olfactory receptor family 2 subfamily A member 12
Synonyms: GA_x6K02T2P3E9-4632269-4631343, MOR261-12, Olfr446
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258292
Homologene: 17179
Rnase6
Name: ribonuclease, RNase A family, 6
Synonyms: 9530043P15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78416
VEGA: 14
Homologene: 4102
Tmem100
Name: transmembrane protein 100
Synonyms: 1810057C19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67888
Homologene: 10110
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 64,714,591 bp (GRCm38)
  • A to G, chromosome 1 at 84,159,311 bp (GRCm38)
  • G to A, chromosome 1 at 172,117,264 bp (GRCm38)
  • T to C, chromosome 2 at 26,905,809 bp (GRCm38)
  • T to A, chromosome 2 at 65,461,252 bp (GRCm38)
  • A to T, chromosome 2 at 86,690,231 bp (GRCm38)
  • T to A, chromosome 2 at 109,131,615 bp (GRCm38)
  • T to C, chromosome 2 at 163,492,615 bp (GRCm38)
  • C to T, chromosome 3 at 110,135,364 bp (GRCm38)
  • T to C, chromosome 4 at 41,023,756 bp (GRCm38)
  • A to G, chromosome 4 at 63,118,587 bp (GRCm38)
  • A to T, chromosome 4 at 112,391,718 bp (GRCm38)
  • T to C, chromosome 4 at 154,015,941 bp (GRCm38)
  • A to G, chromosome 4 at 154,892,510 bp (GRCm38)
  • A to G, chromosome 5 at 32,964,732 bp (GRCm38)
  • T to A, chromosome 5 at 66,676,306 bp (GRCm38)
  • C to T, chromosome 5 at 90,268,649 bp (GRCm38)
  • G to A, chromosome 5 at 130,269,224 bp (GRCm38)
  • T to C, chromosome 5 at 136,224,152 bp (GRCm38)
  • C to T, chromosome 6 at 29,405,961 bp (GRCm38)
  • T to A, chromosome 6 at 42,927,600 bp (GRCm38)
  • A to G, chromosome 6 at 115,838,014 bp (GRCm38)
  • G to A, chromosome 6 at 134,719,019 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to T, chromosome 7 at 6,379,355 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • T to A, chromosome 7 at 63,924,861 bp (GRCm38)
  • G to A, chromosome 7 at 102,090,612 bp (GRCm38)
  • C to T, chromosome 7 at 123,269,101 bp (GRCm38)
  • C to T, chromosome 7 at 128,010,001 bp (GRCm38)
  • G to A, chromosome 8 at 68,294,366 bp (GRCm38)
  • T to C, chromosome 8 at 70,293,576 bp (GRCm38)
  • C to T, chromosome 8 at 70,786,182 bp (GRCm38)
  • T to C, chromosome 8 at 71,355,839 bp (GRCm38)
  • C to T, chromosome 8 at 126,450,723 bp (GRCm38)
  • A to C, chromosome 9 at 22,239,098 bp (GRCm38)
  • A to C, chromosome 9 at 28,903,328 bp (GRCm38)
  • G to A, chromosome 10 at 29,196,779 bp (GRCm38)
  • T to C, chromosome 10 at 130,270,971 bp (GRCm38)
  • T to A, chromosome 11 at 51,048,396 bp (GRCm38)
  • A to T, chromosome 11 at 90,035,707 bp (GRCm38)
  • A to G, chromosome 11 at 116,494,189 bp (GRCm38)
  • A to T, chromosome 13 at 22,219,819 bp (GRCm38)
  • G to A, chromosome 13 at 42,154,775 bp (GRCm38)
  • T to A, chromosome 13 at 67,390,412 bp (GRCm38)
  • G to T, chromosome 13 at 117,220,560 bp (GRCm38)
  • A to T, chromosome 14 at 51,130,405 bp (GRCm38)
  • G to A, chromosome 15 at 65,889,588 bp (GRCm38)
  • G to A, chromosome 15 at 66,913,051 bp (GRCm38)
  • A to G, chromosome 15 at 76,309,587 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • C to A, chromosome 16 at 3,987,956 bp (GRCm38)
  • T to C, chromosome 16 at 5,070,628 bp (GRCm38)
  • T to A, chromosome 16 at 14,200,716 bp (GRCm38)
  • G to A, chromosome 16 at 16,490,489 bp (GRCm38)
  • T to A, chromosome 16 at 19,565,972 bp (GRCm38)
  • G to A, chromosome 17 at 15,405,758 bp (GRCm38)
  • T to C, chromosome 18 at 32,000,360 bp (GRCm38)
  • T to C, chromosome 18 at 35,675,207 bp (GRCm38)
  • C to T, chromosome 18 at 78,783,384 bp (GRCm38)
  • G to A, chromosome 19 at 11,390,344 bp (GRCm38)
  • C to T, chromosome 19 at 46,668,726 bp (GRCm38)
  • A to T, chromosome 19 at 59,345,142 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9364 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069173-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.