Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9365Btlr/Mmmh
Stock Number:
069174-MU
Citation ID:
RRID:MMRRC_069174-MU
Other Names:
R9365 (G1)
Major Collection:

Strain Information

Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Llgl2
Name: LLGL2 scribble cell polarity complex component
Synonyms: 9130006H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217325
HGNC: HGNC:6629
Homologene: 3323
Srfbp1
Name: serum response factor binding protein 1
Synonyms: 2810036K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67222
VEGA: 18
Homologene: 12101
Chchd6
Name: coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms: 1700021B03Rik, 0710001P09Rik, Micos25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66098
Homologene: 11920
Cyb5a
Name: cytochrome b5 type A (microsomal)
Synonyms: 0610009N12Rik, Cyb5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 109672
HGNC: HGNC:2570
Homologene: 41475
Exoc2
Name: exocyst complex component 2
Synonyms: Sec5, 2410030I24Rik, Sec5l1, Gm29675
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66482
Homologene: 10122
Kpna1
Name: karyopherin subunit alpha 1
Synonyms: mSRP1, m-importin-alpha-S1, Rch2, NPI1, importin alpha 5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16646
HGNC: HGNC:6394
Homologene: 55642
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 6,244,893 bp (GRCm38)
  • T to A, chromosome 1 at 125,568,596 bp (GRCm38)
  • T to C, chromosome 2 at 4,602,162 bp (GRCm38)
  • T to C, chromosome 2 at 24,838,710 bp (GRCm38)
  • A to G, chromosome 2 at 66,318,121 bp (GRCm38)
  • C to T, chromosome 2 at 104,907,666 bp (GRCm38)
  • A to G, chromosome 2 at 139,740,401 bp (GRCm38)
  • T to A, chromosome 3 at 88,981,900 bp (GRCm38)
  • T to A, chromosome 3 at 135,248,446 bp (GRCm38)
  • T to C, chromosome 4 at 33,943,798 bp (GRCm38)
  • C to T, chromosome 4 at 42,756,288 bp (GRCm38)
  • C to T, chromosome 4 at 44,340,693 bp (GRCm38)
  • T to C, chromosome 4 at 123,116,796 bp (GRCm38)
  • A to G, chromosome 5 at 48,304,192 bp (GRCm38)
  • A to G, chromosome 5 at 67,349,799 bp (GRCm38)
  • T to A, chromosome 5 at 109,340,198 bp (GRCm38)
  • A to T, chromosome 6 at 72,307,205 bp (GRCm38)
  • G to A, chromosome 6 at 89,574,431 bp (GRCm38)
  • A to G, chromosome 6 at 90,635,345 bp (GRCm38)
  • T to A, chromosome 6 at 132,207,238 bp (GRCm38)
  • G to A, chromosome 6 at 132,572,145 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • C to T, chromosome 7 at 18,610,468 bp (GRCm38)
  • T to C, chromosome 7 at 24,432,447 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • T to A, chromosome 7 at 45,575,870 bp (GRCm38)
  • T to G, chromosome 7 at 46,271,264 bp (GRCm38)
  • A to G, chromosome 7 at 119,967,636 bp (GRCm38)
  • T to A, chromosome 7 at 123,480,368 bp (GRCm38)
  • T to A, chromosome 8 at 33,574,536 bp (GRCm38)
  • A to T, chromosome 8 at 93,048,099 bp (GRCm38)
  • T to C, chromosome 8 at 125,124,546 bp (GRCm38)
  • T to G, chromosome 9 at 7,277,921 bp (GRCm38)
  • T to C, chromosome 9 at 44,950,893 bp (GRCm38)
  • G to A, chromosome 10 at 20,972,136 bp (GRCm38)
  • C to A, chromosome 10 at 41,456,544 bp (GRCm38)
  • T to G, chromosome 10 at 45,709,996 bp (GRCm38)
  • T to C, chromosome 10 at 64,088,164 bp (GRCm38)
  • T to A, chromosome 10 at 89,483,453 bp (GRCm38)
  • T to A, chromosome 11 at 58,994,511 bp (GRCm38)
  • A to G, chromosome 11 at 67,283,806 bp (GRCm38)
  • T to C, chromosome 11 at 115,822,584 bp (GRCm38)
  • A to G, chromosome 11 at 115,849,581 bp (GRCm38)
  • A to T, chromosome 13 at 30,856,714 bp (GRCm38)
  • T to C, chromosome 14 at 27,379,598 bp (GRCm38)
  • G to T, chromosome 14 at 41,982,136 bp (GRCm38)
  • G to T, chromosome 14 at 50,827,140 bp (GRCm38)
  • C to T, chromosome 14 at 55,487,319 bp (GRCm38)
  • A to T, chromosome 14 at 55,704,892 bp (GRCm38)
  • T to A, chromosome 15 at 7,169,040 bp (GRCm38)
  • A to G, chromosome 15 at 71,462,964 bp (GRCm38)
  • C to T, chromosome 15 at 79,738,519 bp (GRCm38)
  • T to C, chromosome 16 at 14,234,433 bp (GRCm38)
  • T to C, chromosome 16 at 17,208,756 bp (GRCm38)
  • T to A, chromosome 16 at 33,104,799 bp (GRCm38)
  • T to G, chromosome 16 at 36,012,917 bp (GRCm38)
  • T to A, chromosome 16 at 36,915,762 bp (GRCm38)
  • T to C, chromosome 18 at 9,848,146 bp (GRCm38)
  • T to G, chromosome 18 at 36,287,860 bp (GRCm38)
  • T to G, chromosome 18 at 36,760,301 bp (GRCm38)
  • T to C, chromosome 18 at 36,954,059 bp (GRCm38)
  • T to G, chromosome 18 at 52,490,468 bp (GRCm38)
  • T to A, chromosome 18 at 77,954,742 bp (GRCm38)
  • T to C, chromosome 18 at 84,876,854 bp (GRCm38)
  • T to C, chromosome Y at 1,099,712 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9365 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069174-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.