Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9365Btlr/Mmmh
Stock Number:
069174-MU
Citation ID:
RRID:MMRRC_069174-MU
Other Names:
R9365 (G1)
Major Collection:

Strain Information

Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Llgl2
Name: LLGL2 scribble cell polarity complex component
Synonyms: 9130006H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217325
HGNC: HGNC:6629
Homologene: 3323
Srfbp1
Name: serum response factor binding protein 1
Synonyms: 2810036K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67222
VEGA: 18
Homologene: 12101
Chchd6
Name: coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms: 1700021B03Rik, 0710001P09Rik, Micos25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66098
Homologene: 11920
Cyb5a
Name: cytochrome b5 type A (microsomal)
Synonyms: 0610009N12Rik, Cyb5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 109672
HGNC: HGNC:2570
Homologene: 41475
Exoc2
Name: exocyst complex component 2
Synonyms: Sec5, 2410030I24Rik, Sec5l1, Gm29675
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66482
Homologene: 10122
Kpna1
Name: karyopherin subunit alpha 1
Synonyms: mSRP1, m-importin-alpha-S1, Rch2, NPI1, importin alpha 5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16646
HGNC: HGNC:6394
Homologene: 55642
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Dhrs4
Name: dehydrogenase/reductase 4
Synonyms: RRD, D14Ucla2, dehydrogenase/reductase (SDR family) member 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 28200
VEGA: 14
Homologene: 49646
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Melk
Name: maternal embryonic leucine zipper kinase
Synonyms: MPK38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17279
Homologene: 32111
Ahi1
Name: Abelson helper integration site 1
Synonyms: Ahi-1, 1700015F03Rik, D10Bwg0629e, Jouberin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52906
VEGA: 10
Homologene: 9762
Slc41a3
Name: solute carrier family 41, member 3
Synonyms: SLC41A1-L2, 1010001P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71699
Homologene: 23052
Cnr1
Name: cannabinoid receptor 1
Synonyms: CB1, CB1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12801
HGNC: HGNC:2159
Homologene: 7273
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Sun2
Name: Sad1 and UNC84 domain containing 2
Synonyms: B230369L08Rik, Unc84b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223697
Homologene: 9113
Epg5
Name: ectopic P-granules 5 autophagy tethering factor
Synonyms: 5430411K18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100502841
VEGA: 18
Homologene: 14575
Uty
Name: ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Synonyms: Hydb
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22290
Lrrtm3
Name: leucine rich repeat transmembrane neuronal 3
Synonyms: 9630044H04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216028
Homologene: 37110
Lifr
Name: LIF receptor alpha
Synonyms: soluble differentiation-stimulating factor receptor, A230075M04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16880
VEGA: 15
HGNC: HGNC:6597
Homologene: 1735
Cenpe
Name: centromere protein E
Synonyms: N-7 kinesin, CENP-E, 312kDa, Kif10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Arhgef3
Name: Rho guanine nucleotide exchange factor 3
Synonyms: 1200004I24Rik, C76747, 9830169H03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71704
VEGA: 14
HGNC: HGNC:683
Homologene: 41329
Slc35f5
Name: solute carrier family 35, member F5
Synonyms: 1300003P13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74150
Homologene: 5745
Colec12
Name: collectin sub-family member 12
Synonyms: SRCL, CL-P1, Scara4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 140792
VEGA: 18
Homologene: 34248
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Bcat2
Name: branched chain aminotransferase 2, mitochondrial
Synonyms: Eca40, Bcat-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12036
HGNC: HGNC:977
Homologene: 81684
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Ccdc73
Name: coiled-coil domain containing 73
Synonyms: 2210415I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211936
Homologene: 52235
Fam135b
Name: family with sequence similarity 135, member B
Synonyms: A830008O07Rik, 1700010C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70363
VEGA: 15
Homologene: 66605
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Zkscan2
Name: zinc finger with KRAB and SCAN domains 2
Synonyms: 9430065N20Rik, Zfp694
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210162
Homologene: 19671
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: LaXp180, 2900055E04Rik, Cc1, 5930404L04Rik, Fip200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Frmd4a
Name: FERM domain containing 4A
Synonyms: C230040M21Rik, 2700017I06Rik, Gm13190
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209630
Homologene: 9971
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Psg23
Name: pregnancy-specific beta-1-glycoprotein 23
Synonyms: 1620401C02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56868
Homologene: 110989
Mmp13
Name: matrix metallopeptidase 13
Synonyms: interstitial collagenase, Collagenase-3, collagenase-1, Clg, Mmp1, MMP-13
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17386
VEGA: 9
HGNC: HGNC:7159
Homologene: 20548
Tsen54
Name: tRNA splicing endonuclease subunit 54
Synonyms: 0610034P02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76265
Homologene: 35476
Irgc
Name: immunity related GTPase cinema
Synonyms: LOC210145, LOC381989, F630044M05Rik, Iigp5, Irgc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210145
Homologene: 10486
Ism1
Name: isthmin 1, angiogenesis inhibitor
Synonyms: 5430433G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319909
Homologene: 19061
Lmln
Name: leishmanolysin-like (metallopeptidase M8 family)
Synonyms: 5330415H22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239833
Homologene: 13198
Ube4a
Name: ubiquitination factor E4A
Synonyms: UFD2b, 9930123J21Rik, 4732444G18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 140630
Homologene: 3517
Tgm1
Name: transglutaminase 1, K polypeptide
Synonyms: protein-glutamine-gamma-glutamyltransferase, K polypeptide, TG K, TGase 1, 2310004J08Rik, TGase1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
Rimbp3
Name: RIMS binding protein 3
Synonyms: LOC239731, LOC385766, RIM-BP3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239731
Homologene: 77940
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384220
Homologene: 104825
Disc1
Name: disrupted in schizophrenia 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244667
HGNC: HGNC:2888
Homologene: 10257
Prb1a
Name: proline-rich protein BstNI subfamily 1A
Synonyms: proline-rich proteoglycan 2, Prb1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381833
Zbtb24
Name: zinc finger and BTB domain containing 24
Synonyms: ZNF450
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268294
VEGA: 10
Homologene: 8870
Oxct2b
Name: 3-oxoacid CoA transferase 2B
Synonyms: Scot-t2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 353371
Homologene: 137359
Slc30a9
Name: solute carrier family 30 (zinc transporter), member 9
Synonyms: 2310024J23Rik, GAC63
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109108
HGNC: HGNC:1329
Homologene: 4627
Ces1a
Name: carboxylesterase 1A
Synonyms: Gm4976
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244595
HGNC: HGNC:1863
Homologene: 134142
Prh1
Name: proline rich protein HaeIII subfamily 1
Synonyms: A-type, MP2, Prp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19131
Nr1h4
Name: nuclear receptor subfamily 1, group H, member 4
Synonyms: RIP14, FXR, HRR1, Rxrip14, Fxr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20186
HGNC: HGNC:7967
Homologene: 3760
Hace1
Name: HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms: A730034A22Rik, 1700042J16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209462
Homologene: 10807
Wdr55
Name: WD repeat domain 55
Synonyms: 2410080P20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67936
VEGA: 18
Homologene: 9789
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Sftpb
Name: surfactant associated protein B
Synonyms: SF-B, SP-B, Sftp-3, Sftp3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20388
Homologene: 456
Pura
Name: purine rich element binding protein A
Synonyms: ssCRE-BP, CAGER-1, Pur-alpha, Pur alpha
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19290
HGNC: HGNC:9701
Homologene: 4279
Pcdha4
Name: protocadherin alpha 4
Synonyms: Cnr1, Crnr1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Ccl19
Name: C-C motif chemokine ligand 19
Synonyms: CKb11, Scya19, exodus-3, Gm2023
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24047
Homologene: 4569
Gm3543
Name: predicted gene 3543
Type: Gene
Species: Mouse
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 6,244,893 bp (GRCm38)
  • T to A, chromosome 1 at 125,568,596 bp (GRCm38)
  • T to C, chromosome 2 at 4,602,162 bp (GRCm38)
  • T to C, chromosome 2 at 24,838,710 bp (GRCm38)
  • A to G, chromosome 2 at 66,318,121 bp (GRCm38)
  • C to T, chromosome 2 at 104,907,666 bp (GRCm38)
  • A to G, chromosome 2 at 139,740,401 bp (GRCm38)
  • T to A, chromosome 3 at 88,981,900 bp (GRCm38)
  • T to A, chromosome 3 at 135,248,446 bp (GRCm38)
  • T to C, chromosome 4 at 33,943,798 bp (GRCm38)
  • C to T, chromosome 4 at 42,756,288 bp (GRCm38)
  • C to T, chromosome 4 at 44,340,693 bp (GRCm38)
  • T to C, chromosome 4 at 123,116,796 bp (GRCm38)
  • A to G, chromosome 5 at 48,304,192 bp (GRCm38)
  • A to G, chromosome 5 at 67,349,799 bp (GRCm38)
  • T to A, chromosome 5 at 109,340,198 bp (GRCm38)
  • A to T, chromosome 6 at 72,307,205 bp (GRCm38)
  • G to A, chromosome 6 at 89,574,431 bp (GRCm38)
  • A to G, chromosome 6 at 90,635,345 bp (GRCm38)
  • T to A, chromosome 6 at 132,207,238 bp (GRCm38)
  • G to A, chromosome 6 at 132,572,145 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • C to T, chromosome 7 at 18,610,468 bp (GRCm38)
  • T to C, chromosome 7 at 24,432,447 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • T to A, chromosome 7 at 45,575,870 bp (GRCm38)
  • T to G, chromosome 7 at 46,271,264 bp (GRCm38)
  • A to G, chromosome 7 at 119,967,636 bp (GRCm38)
  • T to A, chromosome 7 at 123,480,368 bp (GRCm38)
  • T to A, chromosome 8 at 33,574,536 bp (GRCm38)
  • A to T, chromosome 8 at 93,048,099 bp (GRCm38)
  • T to C, chromosome 8 at 125,124,546 bp (GRCm38)
  • T to G, chromosome 9 at 7,277,921 bp (GRCm38)
  • T to C, chromosome 9 at 44,950,893 bp (GRCm38)
  • G to A, chromosome 10 at 20,972,136 bp (GRCm38)
  • C to A, chromosome 10 at 41,456,544 bp (GRCm38)
  • T to G, chromosome 10 at 45,709,996 bp (GRCm38)
  • T to C, chromosome 10 at 64,088,164 bp (GRCm38)
  • T to A, chromosome 10 at 89,483,453 bp (GRCm38)
  • T to A, chromosome 11 at 58,994,511 bp (GRCm38)
  • A to G, chromosome 11 at 67,283,806 bp (GRCm38)
  • T to C, chromosome 11 at 115,822,584 bp (GRCm38)
  • A to G, chromosome 11 at 115,849,581 bp (GRCm38)
  • A to T, chromosome 13 at 30,856,714 bp (GRCm38)
  • T to C, chromosome 14 at 27,379,598 bp (GRCm38)
  • G to T, chromosome 14 at 41,982,136 bp (GRCm38)
  • G to T, chromosome 14 at 50,827,140 bp (GRCm38)
  • C to T, chromosome 14 at 55,487,319 bp (GRCm38)
  • A to T, chromosome 14 at 55,704,892 bp (GRCm38)
  • T to A, chromosome 15 at 7,169,040 bp (GRCm38)
  • A to G, chromosome 15 at 71,462,964 bp (GRCm38)
  • C to T, chromosome 15 at 79,738,519 bp (GRCm38)
  • T to C, chromosome 16 at 14,234,433 bp (GRCm38)
  • T to C, chromosome 16 at 17,208,756 bp (GRCm38)
  • T to A, chromosome 16 at 33,104,799 bp (GRCm38)
  • T to G, chromosome 16 at 36,012,917 bp (GRCm38)
  • T to A, chromosome 16 at 36,915,762 bp (GRCm38)
  • T to C, chromosome 18 at 9,848,146 bp (GRCm38)
  • T to G, chromosome 18 at 36,287,860 bp (GRCm38)
  • T to G, chromosome 18 at 36,760,301 bp (GRCm38)
  • T to C, chromosome 18 at 36,954,059 bp (GRCm38)
  • T to G, chromosome 18 at 52,490,468 bp (GRCm38)
  • T to A, chromosome 18 at 77,954,742 bp (GRCm38)
  • T to C, chromosome 18 at 84,876,854 bp (GRCm38)
  • T to C, chromosome Y at 1,099,712 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9365 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069174-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.