Strain Name:
C57BL/6J-MtgxR9367Btlr/Mmmh
Stock Number:
069176-MU
Citation ID:
RRID:MMRRC_069176-MU
Other Names:
R9367 (G1)
Major Collection:

Strain Information

Sema3e
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20349
Homologene: 8247
Penk
Name: preproenkephalin
Synonyms: ENK, Penk, PPA, Penk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18619
HGNC: HGNC:8831
Homologene: 4528
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Arhgdig
Name: Rho GDP dissociation inhibitor gamma
Synonyms: Rho-GDI-3, RIP2, Rho-GDI2, Gdi5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14570
HGNC: HGNC:680
Homologene: 7337
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Mip
Name: major intrinsic protein of lens fiber
Synonyms: MIP26, Aqp0, Svl, Lop, lens opacity, shrivelled, aquaporin 0, Cts
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17339
HGNC: HGNC:7103
Homologene: 40627
Fam117a
Name: family with sequence similarity 117, member A
Synonyms: 5730593F17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215512
Homologene: 12775
Agpat4
Name: 1-acylglycerol-3-phosphate O-acyltransferase 4
Synonyms: 1500003P24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68262
Homologene: 69293
Naa50
Name: N(alpha)-acetyltransferase 50, NatE catalytic subunit
Synonyms: 2600005K24Rik, 2810441M03Rik, Mak3p, Nat5, Nat13, San
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72117
Homologene: 11851
Rad17
Name: RAD17 checkpoint clamp loader component
Synonyms: MmRad24, 9430035O09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19356
VEGA: 13
HGNC: HGNC:9807
Homologene: 32117
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209018
Homologene: 44592
Ppp1r7
Name: protein phosphatase 1, regulatory subunit 7
Synonyms: SDS22, 2310014J01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66385
HGNC: HGNC:9295
Homologene: 2032
Mmp14
Name: matrix metallopeptidase 14 (membrane-inserted)
Synonyms: Membrane type 1-MMP, MT1-MMP, sabe
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17387
HGNC: HGNC:7160
Homologene: 21040
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Surf6
Name: surfeit gene 6
Synonyms: Surf-6, D2Wsu129e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20935
Homologene: 133981
Zfp869
Name: zinc finger protein 869
Synonyms: U 2-7-1, 1200003I07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66869
VEGA: 8
Homologene: 134644
Echdc2
Name: enoyl Coenzyme A hydratase domain containing 2
Synonyms: 1300017C12Rik, 2610009M20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 52430
Homologene: 23088
Uty
Name: ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Synonyms: Hydb
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22290
Hapln3
Name: hyaluronan and proteoglycan link protein 3
Synonyms: Lpr3, 4930554N11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67666
Homologene: 18654
Mmp27
Name: matrix metallopeptidase 27
Synonyms: LOC234911
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234911
Homologene: 23345
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Ikbkb
Name: inhibitor of kappaB kinase beta
Synonyms: IKK-beta, IKK-2, IKK2, IKK[b], IKKbeta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16150
HGNC: HGNC:5960
Homologene: 7782
Pwp2
Name: PWP2 periodic tryptophan protein homolog (yeast)
Synonyms: Pwp2, 6530411D08Rik, Pwp2h
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110816
VEGA: 10
HGNC: HGNC:9711
Homologene: 3702
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Gle1
Name: GLE1 RNA export mediator
Synonyms: 4933405K21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74412
HGNC: HGNC:4315
Homologene: 20379
Bcl9
Name: B cell CLL/lymphoma 9
Synonyms: 8030475K17Rik, A330041G23Rik, 2610202E01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77578
HGNC: HGNC:1008
Homologene: 3191
Tcerg1
Name: transcription elongation regulator 1 (CA150)
Synonyms: p144, ca150, Taf2s, 2410022J09Rik, 2900090C16Rik, Fbp28
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56070
Homologene: 4879
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: MOZ, Zfp220, 9930021N24Rik, Myst3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Stk10
Name: serine/threonine kinase 10
Synonyms: Lok, Gek1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20868
Homologene: 38122
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Trp53i11
Name: transformation related protein 53 inducible protein 11
Synonyms: Tp53i11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277414
Homologene: 4404
Gen1
Name: GEN1, Holliday junction 5' flap endonuclease
Synonyms: 5830483C08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209334
VEGA: 12
Homologene: 35313
Akip1
Name: A kinase interacting protein 1
Synonyms: ICRFP703N2430Q5.6, D7H11orf17, BCA3, ORF27, ICRFP703B1614Q5.6, D930014E17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57373
HGNC: HGNC:1170
Homologene: 10765
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ssu2
Name: ssu-2 homolog
Synonyms: D630042P16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243612
Homologene: 136556
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Arhgef38
Name: Rho guanine nucleotide exchange factor 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77669
Homologene: 137396
Ccdc150
Name: coiled-coil domain containing 150
Synonyms: 4930511H11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78016
Homologene: 15814
Tspan9
Name: tetraspanin 9
Synonyms: 6720474K14Rik, 9430079M16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109246
Homologene: 4860
Baat
Name: bile acid-Coenzyme A: amino acid N-acyltransferase
Synonyms: BAT, taurine N-acyltransferase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12012
HGNC: HGNC:932
Homologene: 1286
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
4930568D16Rik
Name: RIKEN cDNA 4930568D16 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75859
Homologene: 86865
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Ceacam20
Name: CEA cell adhesion molecule 20
Synonyms: 9130012D09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71601
Homologene: 19010
Dio2
Name: deiodinase, iodothyronine, type II
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13371
VEGA: 12
HGNC: HGNC:2884
Homologene: 621
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: 1200011I03Rik, Mamdc3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74762
Homologene: 17780
Pcdhb15
Name: protocadherin beta 15
Synonyms: Pcdhb7, PcdhbO
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93886
HGNC: HGNC:8692
Homologene: 32429
Acer3
Name: alkaline ceramidase 3
Synonyms: 5430429L08Rik, 1110057L18Rik, Phca
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66190
Homologene: 5410
Cnppd1
Name: cyclin Pas1/PHO80 domain containing 1
Synonyms: 1810031K17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69171
Homologene: 9238
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98733
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Lmo3
Name: LIM domain only 3
Synonyms: Rbtn-3, Rbtn3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109593
HGNC: HGNC:6643
Homologene: 38552
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241633
Homologene: 133162
Fbxl12
Name: F-box and leucine-rich repeat protein 12
Synonyms: 3110048D16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30843
Homologene: 32198
Atp8a2
Name: ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonyms: Ib, wl, agil
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50769
Homologene: 4443
Usp16
Name: ubiquitin specific peptidase 16
Synonyms: 2810483I07Rik, UBP-M, 1200004E02Rik, 6330514E22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74112
Homologene: 38183
Habp2
Name: hyaluronic acid binding protein 2
Synonyms: FSAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226243
HGNC: HGNC:4798
Homologene: 3050
Slc22a2
Name: solute carrier family 22 (organic cation transporter), member 2
Synonyms: Oct2, Orct2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20518
VEGA: 17
Homologene: 68293
Prr27
Name: proline rich 27
Synonyms: 4930432K09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73779
Homologene: 136277
Mylk4
Name: myosin light chain kinase family, member 4
Synonyms: EG238564
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238564
Homologene: 66243
Rhebl1
Name: Ras homolog enriched in brain like 1
Synonyms: 1810036J22Rik, Rheb2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69159
Homologene: 5477
Lrrc32
Name: leucine rich repeat containing 32
Synonyms: D7H11S833E, D11S833Eh, Garp, EG434215
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434215
HGNC: HGNC:4161
Homologene: 4027
Nyap1
Name: neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms: Nyap1, 6430598A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243300
Homologene: 18320
Vmn1r192
Name: vomeronasal 1 receptor 192
Synonyms: V1ri1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252907
Homologene: 110880
Pde2a
Name: phosphodiesterase 2A, cGMP-stimulated
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207728
HGNC: HGNC:8777
Homologene: 1952
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Gimap4
Name: GTPase, IMAP family member 4
Synonyms: E430007K16Rik, Ian1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107526
Homologene: 75084
Gpr135
Name: G protein-coupled receptor 135
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238252
VEGA: 12
Homologene: 11211
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 54,285,601 bp (GRCm38)
  • T to C, chromosome 1 at 75,140,973 bp (GRCm38)
  • A to G, chromosome 1 at 75,489,533 bp (GRCm38)
  • T to C, chromosome 1 at 93,351,540 bp (GRCm38)
  • T to C, chromosome 1 at 158,956,972 bp (GRCm38)
  • G to T, chromosome 2 at 26,892,368 bp (GRCm38)
  • T to A, chromosome 2 at 29,949,002 bp (GRCm38)
  • A to T, chromosome 2 at 35,354,927 bp (GRCm38)
  • G to C, chromosome 2 at 93,198,928 bp (GRCm38)
  • A to G, chromosome 2 at 126,374,510 bp (GRCm38)
  • A to T, chromosome 2 at 130,739,460 bp (GRCm38)
  • A to T, chromosome 2 at 161,029,864 bp (GRCm38)
  • T to C, chromosome 3 at 97,210,545 bp (GRCm38)
  • T to C, chromosome 3 at 122,044,548 bp (GRCm38)
  • T to C, chromosome 3 at 126,945,029 bp (GRCm38)
  • T to A, chromosome 3 at 133,142,237 bp (GRCm38)
  • C to T, chromosome 4 at 4,134,097 bp (GRCm38)
  • T to C, chromosome 4 at 47,245,603 bp (GRCm38)
  • T to A, chromosome 4 at 49,503,008 bp (GRCm38)
  • C to A, chromosome 4 at 108,178,914 bp (GRCm38)
  • G to T, chromosome 5 at 14,241,070 bp (GRCm38)
  • G to A, chromosome 5 at 20,561,310 bp (GRCm38)
  • C to A, chromosome 5 at 87,843,135 bp (GRCm38)
  • T to C, chromosome 5 at 110,297,089 bp (GRCm38)
  • A to T, chromosome 5 at 137,735,986 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • A to G, chromosome 6 at 48,690,812 bp (GRCm38)
  • T to A, chromosome 6 at 107,568,132 bp (GRCm38)
  • A to G, chromosome 6 at 112,381,014 bp (GRCm38)
  • A to G, chromosome 6 at 127,967,139 bp (GRCm38)
  • A to T, chromosome 6 at 138,365,960 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • T to G, chromosome 7 at 19,971,608 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • G to T, chromosome 7 at 79,121,707 bp (GRCm38)
  • A to G, chromosome 7 at 98,259,414 bp (GRCm38)
  • T to A, chromosome 7 at 98,499,730 bp (GRCm38)
  • G to A, chromosome 7 at 101,511,154 bp (GRCm38)
  • C to T, chromosome 7 at 109,708,949 bp (GRCm38)
  • A to G, chromosome 8 at 22,681,695 bp (GRCm38)
  • A to T, chromosome 8 at 22,910,140 bp (GRCm38)
  • A to C, chromosome 8 at 69,708,407 bp (GRCm38)
  • C to T, chromosome 9 at 7,125,730 bp (GRCm38)
  • G to A, chromosome 9 at 7,573,549 bp (GRCm38)
  • A to G, chromosome 9 at 20,638,834 bp (GRCm38)
  • T to A, chromosome 9 at 108,581,948 bp (GRCm38)
  • G to A, chromosome 10 at 78,178,993 bp (GRCm38)
  • G to T, chromosome 10 at 128,227,160 bp (GRCm38)
  • T to C, chromosome 11 at 21,300,234 bp (GRCm38)
  • A to G, chromosome 11 at 32,588,878 bp (GRCm38)
  • T to A, chromosome 11 at 95,380,744 bp (GRCm38)
  • A to G, chromosome 11 at 118,096,638 bp (GRCm38)
  • A to G, chromosome 11 at 118,121,386 bp (GRCm38)
  • G to A, chromosome 12 at 11,241,308 bp (GRCm38)
  • A to T, chromosome 12 at 72,070,699 bp (GRCm38)
  • T to C, chromosome 12 at 90,729,813 bp (GRCm38)
  • A to T, chromosome 13 at 22,187,630 bp (GRCm38)
  • A to T, chromosome 13 at 32,776,253 bp (GRCm38)
  • A to T, chromosome 13 at 100,633,212 bp (GRCm38)
  • T to C, chromosome 14 at 54,440,503 bp (GRCm38)
  • C to A, chromosome 14 at 60,012,378 bp (GRCm38)
  • A to T, chromosome 15 at 47,704,168 bp (GRCm38)
  • C to T, chromosome 15 at 98,878,533 bp (GRCm38)
  • T to C, chromosome 16 at 21,521,918 bp (GRCm38)
  • T to G, chromosome 16 at 44,157,191 bp (GRCm38)
  • C to T, chromosome 16 at 87,464,781 bp (GRCm38)
  • A to G, chromosome 17 at 12,216,710 bp (GRCm38)
  • A to T, chromosome 17 at 12,605,950 bp (GRCm38)
  • A to T, chromosome 17 at 26,199,477 bp (GRCm38)
  • T to C, chromosome 17 at 29,832,308 bp (GRCm38)
  • C to A, chromosome 17 at 34,713,019 bp (GRCm38)
  • A to T, chromosome 18 at 10,522,130 bp (GRCm38)
  • A to T, chromosome 18 at 37,474,918 bp (GRCm38)
  • G to A, chromosome 18 at 42,552,508 bp (GRCm38)
  • G to T, chromosome 19 at 56,316,349 bp (GRCm38)
  • A to T, chromosome Y at 1,099,584 bp (GRCm38)
  • A to T, chromosome Y at 1,324,982 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9367 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069176-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.