Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9367Btlr/Mmmh
Stock Number:
069176-MU
Citation ID:
RRID:MMRRC_069176-MU
Other Names:
R9367 (G1)
Major Collection:

Strain Information

Sema3e
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20349
Homologene: 8247
Penk
Name: preproenkephalin
Synonyms: ENK, Penk, PPA, Penk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18619
HGNC: HGNC:8831
Homologene: 4528
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Arhgdig
Name: Rho GDP dissociation inhibitor gamma
Synonyms: Rho-GDI-3, RIP2, Rho-GDI2, Gdi5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14570
HGNC: HGNC:680
Homologene: 7337
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 54,285,601 bp (GRCm38)
  • T to C, chromosome 1 at 75,140,973 bp (GRCm38)
  • A to G, chromosome 1 at 75,489,533 bp (GRCm38)
  • T to C, chromosome 1 at 93,351,540 bp (GRCm38)
  • T to C, chromosome 1 at 158,956,972 bp (GRCm38)
  • G to T, chromosome 2 at 26,892,368 bp (GRCm38)
  • T to A, chromosome 2 at 29,949,002 bp (GRCm38)
  • A to T, chromosome 2 at 35,354,927 bp (GRCm38)
  • G to C, chromosome 2 at 93,198,928 bp (GRCm38)
  • A to G, chromosome 2 at 126,374,510 bp (GRCm38)
  • A to T, chromosome 2 at 130,739,460 bp (GRCm38)
  • A to T, chromosome 2 at 161,029,864 bp (GRCm38)
  • T to C, chromosome 3 at 97,210,545 bp (GRCm38)
  • T to C, chromosome 3 at 122,044,548 bp (GRCm38)
  • T to C, chromosome 3 at 126,945,029 bp (GRCm38)
  • T to A, chromosome 3 at 133,142,237 bp (GRCm38)
  • C to T, chromosome 4 at 4,134,097 bp (GRCm38)
  • T to C, chromosome 4 at 47,245,603 bp (GRCm38)
  • T to A, chromosome 4 at 49,503,008 bp (GRCm38)
  • C to A, chromosome 4 at 108,178,914 bp (GRCm38)
  • G to T, chromosome 5 at 14,241,070 bp (GRCm38)
  • G to A, chromosome 5 at 20,561,310 bp (GRCm38)
  • C to A, chromosome 5 at 87,843,135 bp (GRCm38)
  • T to C, chromosome 5 at 110,297,089 bp (GRCm38)
  • A to T, chromosome 5 at 137,735,986 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • A to G, chromosome 6 at 48,690,812 bp (GRCm38)
  • T to A, chromosome 6 at 107,568,132 bp (GRCm38)
  • A to G, chromosome 6 at 112,381,014 bp (GRCm38)
  • A to G, chromosome 6 at 127,967,139 bp (GRCm38)
  • A to T, chromosome 6 at 138,365,960 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • T to G, chromosome 7 at 19,971,608 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • G to T, chromosome 7 at 79,121,707 bp (GRCm38)
  • A to G, chromosome 7 at 98,259,414 bp (GRCm38)
  • T to A, chromosome 7 at 98,499,730 bp (GRCm38)
  • G to A, chromosome 7 at 101,511,154 bp (GRCm38)
  • C to T, chromosome 7 at 109,708,949 bp (GRCm38)
  • A to G, chromosome 8 at 22,681,695 bp (GRCm38)
  • A to T, chromosome 8 at 22,910,140 bp (GRCm38)
  • A to C, chromosome 8 at 69,708,407 bp (GRCm38)
  • C to T, chromosome 9 at 7,125,730 bp (GRCm38)
  • G to A, chromosome 9 at 7,573,549 bp (GRCm38)
  • A to G, chromosome 9 at 20,638,834 bp (GRCm38)
  • T to A, chromosome 9 at 108,581,948 bp (GRCm38)
  • G to A, chromosome 10 at 78,178,993 bp (GRCm38)
  • G to T, chromosome 10 at 128,227,160 bp (GRCm38)
  • T to C, chromosome 11 at 21,300,234 bp (GRCm38)
  • A to G, chromosome 11 at 32,588,878 bp (GRCm38)
  • T to A, chromosome 11 at 95,380,744 bp (GRCm38)
  • A to G, chromosome 11 at 118,096,638 bp (GRCm38)
  • A to G, chromosome 11 at 118,121,386 bp (GRCm38)
  • G to A, chromosome 12 at 11,241,308 bp (GRCm38)
  • A to T, chromosome 12 at 72,070,699 bp (GRCm38)
  • T to C, chromosome 12 at 90,729,813 bp (GRCm38)
  • A to T, chromosome 13 at 22,187,630 bp (GRCm38)
  • A to T, chromosome 13 at 32,776,253 bp (GRCm38)
  • A to T, chromosome 13 at 100,633,212 bp (GRCm38)
  • T to C, chromosome 14 at 54,440,503 bp (GRCm38)
  • C to A, chromosome 14 at 60,012,378 bp (GRCm38)
  • A to T, chromosome 15 at 47,704,168 bp (GRCm38)
  • C to T, chromosome 15 at 98,878,533 bp (GRCm38)
  • T to C, chromosome 16 at 21,521,918 bp (GRCm38)
  • T to G, chromosome 16 at 44,157,191 bp (GRCm38)
  • C to T, chromosome 16 at 87,464,781 bp (GRCm38)
  • A to G, chromosome 17 at 12,216,710 bp (GRCm38)
  • A to T, chromosome 17 at 12,605,950 bp (GRCm38)
  • A to T, chromosome 17 at 26,199,477 bp (GRCm38)
  • T to C, chromosome 17 at 29,832,308 bp (GRCm38)
  • C to A, chromosome 17 at 34,713,019 bp (GRCm38)
  • A to T, chromosome 18 at 10,522,130 bp (GRCm38)
  • A to T, chromosome 18 at 37,474,918 bp (GRCm38)
  • G to A, chromosome 18 at 42,552,508 bp (GRCm38)
  • G to T, chromosome 19 at 56,316,349 bp (GRCm38)
  • A to T, chromosome Y at 1,099,584 bp (GRCm38)
  • A to T, chromosome Y at 1,324,982 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9367 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069176-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.