Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9368Btlr/Mmmh
Stock Number:
069177-MU
Citation ID:
RRID:MMRRC_069177-MU
Other Names:
R9368 (G1)
Major Collection:

Strain Information

Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72750
Homologene: 18307
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Gm46500, Sept3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Emb
Name: embigin
Synonyms: Gp70
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13723
Homologene: 7743
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Cacybp
Name: calcyclin binding protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12301
Homologene: 7649
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP-2, C330012H03Rik, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Swt1
Name: SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms: 1200016B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66875
Homologene: 32355
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Ticrr
Name: TOPBP1-interacting checkpoint and replication regulator
Synonyms: 5730590G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77011
Homologene: 67120
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Tyw1
Name: tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms: Rsafd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100929
Homologene: 7068
Ap2a2
Name: adaptor-related protein complex 2, alpha 2 subunit
Synonyms: alpha-C adaptin, alpha-adaptin C, L25, Adtab, 2410074K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11772
HGNC: HGNC:562
Homologene: 5335
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Rttn
Name: rotatin
Synonyms: 4921538A15Rik, C530033I08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Ints13
Name: integrator complex subunit 13
Synonyms: Spata30, 4933424B01Rik, Asun
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71177
Homologene: 10043
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Ap4m1
Name: adaptor-related protein complex AP-4, mu 1
Synonyms: 4930443L05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11781
HGNC: HGNC:574
Homologene: 3467
Slc18a2
Name: solute carrier family 18 (vesicular monoamine), member 2
Synonyms: Vmat2, 1110037L13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 214084
VEGA: 19
Homologene: 2298
Bicc1
Name: BicC family RNA binding protein 1
Synonyms: Bic-C, jcpk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83675
Homologene: 12856
Fgfr3
Name: fibroblast growth factor receptor 3
Synonyms: HBGFR, Fgfr-3, sam3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14184
HGNC: HGNC:3690
Homologene: 55437
Alb
Name: albumin
Synonyms: Alb-1, Alb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11657
HGNC: HGNC:399
Homologene: 405
Chsy1
Name: chondroitin sulfate synthase 1
Synonyms: skt
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269941
Homologene: 8950
Fcrl2
Name: Fc receptor like 2
Synonyms: 2810439C17Rik, IFGP2, Fcrh2, moFcRH2sc, Msr2, Fcrls
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80891
Homologene: 57117
Rpn2
Name: ribophorin II
Synonyms: Rpn-2, 1300012C06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20014
Homologene: 2214
Nup88
Name: nucleoporin 88
Synonyms: Nup84, Prei2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19069
HGNC: HGNC:8067
Homologene: 1901
Prmt9
Name: protein arginine methyltransferase 9
Synonyms: Prmt10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102182
Homologene: 16298
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Frmd6
Name: FERM domain containing 6
Synonyms: 2610019M19Rik, 4930488L10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319710
VEGA: 12
Homologene: 12449
Pi16
Name: peptidase inhibitor 16
Synonyms: 1200009H11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74116
Homologene: 134317
Tcaim
Name: T cell activation inhibitor, mitochondrial
Synonyms: LOC382117, D9Ertd402e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382117
Homologene: 45481
Nlgn1
Name: neuroligin 1
Synonyms: 6330415N05Rik, NL1, Nlg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192167
Homologene: 56690
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Kif5c
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16574
HGNC: HGNC:6325
Homologene: 56234
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Pdzd8
Name: PDZ domain containing 8
Synonyms: A630041P07Rik, Pdzk8
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Trim45
Name: tripartite motif-containing 45
Synonyms: 4921530N01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229644
Homologene: 11865
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245026
Homologene: 18260
Mre11a
Name: MRE11A homolog A, double strand break repair nuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17535
HGNC: HGNC:7230
Homologene: 4083
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: SUR2B, SUR2A, Sur2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Slc15a2
Name: solute carrier family 15 (H+/peptide transporter), member 2
Synonyms: Pept2, 8430408C16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57738
Homologene: 56912
Sppl2c
Name: signal peptide peptidase 2C
Synonyms: 4933407P14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237958
Homologene: 18491
Zfp454
Name: zinc finger protein 454
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237758
Homologene: 72226
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Or6c212
Name: olfactory receptor family 6 subfamily C member 212
Synonyms: GA_x6K02T2PULF-11402237-11401278, MOR110-4, Olfr805
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258548
Cyp3a57
Name: cytochrome P450, family 3, subfamily a, polypeptide 57
Synonyms: EG622127
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622127
Homologene: 135775
Or5h19
Name: olfactory receptor family 5 subfamily H member 19
Synonyms: GA_x54KRFPKG5P-55265713-55264787, MOR183-8, Olfr187
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258319
Homologene: 133069
Plxnc1
Name: plexin C1
Synonyms: vespr, CD232, 2510048K12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Aldh1l2
Name: aldehyde dehydrogenase 1 family, member L2
Synonyms: D330038I09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216188
Homologene: 51942
Begain
Name: brain-enriched guanylate kinase-associated
Synonyms: LOC380785
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380785
Homologene: 10829
Cd1d1
Name: CD1d1 antigen
Synonyms: CD1.1, Cd1a, Cd1d, Ly-38
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12479
HGNC: HGNC:1637
Homologene: 1337
Zdhhc7
Name: zinc finger, DHHC domain containing 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102193
Homologene: 41193
Wdr35
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74682
Homologene: 10814
Or3a1
Name: olfactory receptor family 3 subfamily A member 1
Synonyms: GA_x6K02T2P1NL-4467421-4466474, MOR255-5, Olfr410
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258702
HGNC: HGNC:8282
Homologene: 68262
Ffar1
Name: free fatty acid receptor 1
Synonyms: Gpr40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233081
HGNC: HGNC:4498
Homologene: 3876
Zfp316
Name: zinc finger protein 316
Synonyms: Emzf1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54201
Homologene: 69231
Mical1
Name: microtubule associated monooxygenase, calponin and LIM domain containing 1
Synonyms: Nical
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 171580
Homologene: 11246
Cpne4
Name: copine IV
Synonyms: 3632411M23Rik, 4933406O10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74020
HGNC: HGNC:2317
Homologene: 26078
Tgfbr3l
Name: transforming growth factor, beta receptor III-like
Synonyms: LOC100039590, Gm14378
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100044509
Homologene: 130375
Vmn2r71
Name: vomeronasal 2, receptor 71
Synonyms: EG233445
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233445
Homologene: 115466
Arsj
Name: arylsulfatase J
Synonyms: 9330196J05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 271970
Homologene: 35257
Mcpt4
Name: mast cell protease 4
Synonyms: myonase, MMCP-4B, MMCP-4A, MMCP-4, Mcp-4, Mcp4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17227
VEGA: 14
Homologene: 130645
Hoxc10
Name: homeobox C10
Synonyms: Hox-3.6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209448
HGNC: HGNC:5122
Homologene: 9680
Poglut1
Name: protein O-glucosyltransferase 1
Synonyms: 9630046K23Rik, Ktelc1, Rumi, wsnp
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224143
Homologene: 41353
Sftpa1
Name: surfactant associated protein A1
Synonyms: SP-A, surfactant pulmonary associated protein A1, SFTPA1, Sftp-1, Sftp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20387
Homologene: 3946
Cct8l1
Name: chaperonin containing TCP1 subunit 8-like 1
Synonyms: LOC242891, Gm443
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242891
Homologene: 40943
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Lrrc61
Name: leucine rich repeat containing 61
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243371
Homologene: 41538
Glipr1l3
Name: GLI pathogenesis-related 1 like 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544736
VEGA: 10
Homologene: 83452
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 59,981,581 bp (GRCm38)
  • G to A, chromosome 1 at 65,268,742 bp (GRCm38)
  • A to G, chromosome 1 at 151,411,016 bp (GRCm38)
  • T to C, chromosome 1 at 160,203,638 bp (GRCm38)
  • A to T, chromosome 2 at 49,732,780 bp (GRCm38)
  • T to C, chromosome 2 at 69,527,635 bp (GRCm38)
  • A to G, chromosome 2 at 82,980,695 bp (GRCm38)
  • G to T, chromosome 2 at 157,299,580 bp (GRCm38)
  • T to C, chromosome 3 at 25,434,458 bp (GRCm38)
  • C to A, chromosome 3 at 86,998,632 bp (GRCm38)
  • C to T, chromosome 3 at 87,257,599 bp (GRCm38)
  • A to T, chromosome 3 at 100,925,003 bp (GRCm38)
  • C to T, chromosome 3 at 126,439,096 bp (GRCm38)
  • A to G, chromosome 4 at 117,104,772 bp (GRCm38)
  • A to G, chromosome 5 at 25,516,338 bp (GRCm38)
  • G to A, chromosome 5 at 33,727,872 bp (GRCm38)
  • A to G, chromosome 5 at 63,804,963 bp (GRCm38)
  • T to C, chromosome 5 at 90,244,127 bp (GRCm38)
  • C to T, chromosome 5 at 90,268,649 bp (GRCm38)
  • A to G, chromosome 5 at 90,475,284 bp (GRCm38)
  • G to A, chromosome 5 at 130,269,224 bp (GRCm38)
  • T to A, chromosome 5 at 138,177,183 bp (GRCm38)
  • A to G, chromosome 5 at 143,264,291 bp (GRCm38)
  • A to G, chromosome 5 at 145,381,349 bp (GRCm38)
  • A to G, chromosome 5 at 150,477,938 bp (GRCm38)
  • T to C, chromosome 6 at 48,568,311 bp (GRCm38)
  • A to T, chromosome 6 at 73,021,278 bp (GRCm38)
  • A to T, chromosome 6 at 89,337,156 bp (GRCm38)
  • A to T, chromosome 6 at 142,694,525 bp (GRCm38)
  • T to C, chromosome 6 at 146,565,631 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to G, chromosome 7 at 30,861,032 bp (GRCm38)
  • A to G, chromosome 7 at 66,171,751 bp (GRCm38)
  • A to G, chromosome 7 at 79,680,987 bp (GRCm38)
  • T to A, chromosome 7 at 85,624,234 bp (GRCm38)
  • T to C, chromosome 7 at 141,627,902 bp (GRCm38)
  • T to C, chromosome 8 at 4,249,640 bp (GRCm38)
  • T to G, chromosome 8 at 77,559,034 bp (GRCm38)
  • G to T, chromosome 8 at 120,087,755 bp (GRCm38)
  • T to A, chromosome 9 at 14,825,218 bp (GRCm38)
  • A to T, chromosome 9 at 104,686,539 bp (GRCm38)
  • T to C, chromosome 9 at 105,786,101 bp (GRCm38)
  • C to A, chromosome 9 at 122,818,863 bp (GRCm38)
  • T to A, chromosome 10 at 41,481,306 bp (GRCm38)
  • A to G, chromosome 10 at 69,987,499 bp (GRCm38)
  • A to T, chromosome 10 at 70,950,087 bp (GRCm38)
  • A to T, chromosome 10 at 83,495,952 bp (GRCm38)
  • T to A, chromosome 10 at 94,864,737 bp (GRCm38)
  • G to A, chromosome 10 at 112,148,018 bp (GRCm38)
  • A to T, chromosome 10 at 129,723,012 bp (GRCm38)
  • G to C, chromosome 11 at 50,873,710 bp (GRCm38)
  • C to T, chromosome 11 at 69,360,374 bp (GRCm38)
  • T to C, chromosome 11 at 70,967,930 bp (GRCm38)
  • A to G, chromosome 11 at 74,334,367 bp (GRCm38)
  • G to A, chromosome 11 at 104,187,735 bp (GRCm38)
  • G to A, chromosome 12 at 9,021,826 bp (GRCm38)
  • T to A, chromosome 12 at 70,887,091 bp (GRCm38)
  • T to C, chromosome 12 at 98,796,578 bp (GRCm38)
  • G to T, chromosome 12 at 109,033,992 bp (GRCm38)
  • G to T, chromosome 13 at 117,220,560 bp (GRCm38)
  • G to T, chromosome 14 at 41,132,460 bp (GRCm38)
  • T to C, chromosome 14 at 56,061,677 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • A to T, chromosome 15 at 82,279,538 bp (GRCm38)
  • A to G, chromosome 15 at 102,970,947 bp (GRCm38)
  • T to A, chromosome 16 at 22,065,145 bp (GRCm38)
  • C to T, chromosome 16 at 32,794,101 bp (GRCm38)
  • G to A, chromosome 16 at 36,753,718 bp (GRCm38)
  • A to G, chromosome 16 at 38,529,488 bp (GRCm38)
  • C to T, chromosome 16 at 59,036,315 bp (GRCm38)
  • G to A, chromosome 16 at 77,107,955 bp (GRCm38)
  • T to A, chromosome 17 at 29,327,878 bp (GRCm38)
  • A to G, chromosome 17 at 71,387,076 bp (GRCm38)
  • A to C, chromosome 18 at 89,060,452 bp (GRCm38)
  • C to T, chromosome 19 at 59,274,359 bp (GRCm38)
  • A to T, chromosome 19 at 59,300,787 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9368 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069177-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.