Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9368Btlr/Mmmh
Stock Number:
069177-MU
Citation ID:
RRID:MMRRC_069177-MU
Other Names:
R9368 (G1)
Major Collection:

Strain Information

Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72750
Homologene: 18307
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Gm46500, Sept3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Emb
Name: embigin
Synonyms: Gp70
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13723
Homologene: 7743
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Cacybp
Name: calcyclin binding protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12301
Homologene: 7649
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 59,981,581 bp (GRCm38)
  • G to A, chromosome 1 at 65,268,742 bp (GRCm38)
  • A to G, chromosome 1 at 151,411,016 bp (GRCm38)
  • T to C, chromosome 1 at 160,203,638 bp (GRCm38)
  • A to T, chromosome 2 at 49,732,780 bp (GRCm38)
  • T to C, chromosome 2 at 69,527,635 bp (GRCm38)
  • A to G, chromosome 2 at 82,980,695 bp (GRCm38)
  • G to T, chromosome 2 at 157,299,580 bp (GRCm38)
  • T to C, chromosome 3 at 25,434,458 bp (GRCm38)
  • C to A, chromosome 3 at 86,998,632 bp (GRCm38)
  • C to T, chromosome 3 at 87,257,599 bp (GRCm38)
  • A to T, chromosome 3 at 100,925,003 bp (GRCm38)
  • C to T, chromosome 3 at 126,439,096 bp (GRCm38)
  • A to G, chromosome 4 at 117,104,772 bp (GRCm38)
  • A to G, chromosome 5 at 25,516,338 bp (GRCm38)
  • G to A, chromosome 5 at 33,727,872 bp (GRCm38)
  • A to G, chromosome 5 at 63,804,963 bp (GRCm38)
  • T to C, chromosome 5 at 90,244,127 bp (GRCm38)
  • C to T, chromosome 5 at 90,268,649 bp (GRCm38)
  • A to G, chromosome 5 at 90,475,284 bp (GRCm38)
  • G to A, chromosome 5 at 130,269,224 bp (GRCm38)
  • T to A, chromosome 5 at 138,177,183 bp (GRCm38)
  • A to G, chromosome 5 at 143,264,291 bp (GRCm38)
  • A to G, chromosome 5 at 145,381,349 bp (GRCm38)
  • A to G, chromosome 5 at 150,477,938 bp (GRCm38)
  • T to C, chromosome 6 at 48,568,311 bp (GRCm38)
  • A to T, chromosome 6 at 73,021,278 bp (GRCm38)
  • A to T, chromosome 6 at 89,337,156 bp (GRCm38)
  • A to T, chromosome 6 at 142,694,525 bp (GRCm38)
  • T to C, chromosome 6 at 146,565,631 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to G, chromosome 7 at 30,861,032 bp (GRCm38)
  • A to G, chromosome 7 at 66,171,751 bp (GRCm38)
  • A to G, chromosome 7 at 79,680,987 bp (GRCm38)
  • T to A, chromosome 7 at 85,624,234 bp (GRCm38)
  • T to C, chromosome 7 at 141,627,902 bp (GRCm38)
  • T to C, chromosome 8 at 4,249,640 bp (GRCm38)
  • T to G, chromosome 8 at 77,559,034 bp (GRCm38)
  • G to T, chromosome 8 at 120,087,755 bp (GRCm38)
  • T to A, chromosome 9 at 14,825,218 bp (GRCm38)
  • A to T, chromosome 9 at 104,686,539 bp (GRCm38)
  • T to C, chromosome 9 at 105,786,101 bp (GRCm38)
  • C to A, chromosome 9 at 122,818,863 bp (GRCm38)
  • T to A, chromosome 10 at 41,481,306 bp (GRCm38)
  • A to G, chromosome 10 at 69,987,499 bp (GRCm38)
  • A to T, chromosome 10 at 70,950,087 bp (GRCm38)
  • A to T, chromosome 10 at 83,495,952 bp (GRCm38)
  • T to A, chromosome 10 at 94,864,737 bp (GRCm38)
  • G to A, chromosome 10 at 112,148,018 bp (GRCm38)
  • A to T, chromosome 10 at 129,723,012 bp (GRCm38)
  • G to C, chromosome 11 at 50,873,710 bp (GRCm38)
  • C to T, chromosome 11 at 69,360,374 bp (GRCm38)
  • T to C, chromosome 11 at 70,967,930 bp (GRCm38)
  • A to G, chromosome 11 at 74,334,367 bp (GRCm38)
  • G to A, chromosome 11 at 104,187,735 bp (GRCm38)
  • G to A, chromosome 12 at 9,021,826 bp (GRCm38)
  • T to A, chromosome 12 at 70,887,091 bp (GRCm38)
  • T to C, chromosome 12 at 98,796,578 bp (GRCm38)
  • G to T, chromosome 12 at 109,033,992 bp (GRCm38)
  • G to T, chromosome 13 at 117,220,560 bp (GRCm38)
  • G to T, chromosome 14 at 41,132,460 bp (GRCm38)
  • T to C, chromosome 14 at 56,061,677 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • A to T, chromosome 15 at 82,279,538 bp (GRCm38)
  • A to G, chromosome 15 at 102,970,947 bp (GRCm38)
  • T to A, chromosome 16 at 22,065,145 bp (GRCm38)
  • C to T, chromosome 16 at 32,794,101 bp (GRCm38)
  • G to A, chromosome 16 at 36,753,718 bp (GRCm38)
  • A to G, chromosome 16 at 38,529,488 bp (GRCm38)
  • C to T, chromosome 16 at 59,036,315 bp (GRCm38)
  • G to A, chromosome 16 at 77,107,955 bp (GRCm38)
  • T to A, chromosome 17 at 29,327,878 bp (GRCm38)
  • A to G, chromosome 17 at 71,387,076 bp (GRCm38)
  • A to C, chromosome 18 at 89,060,452 bp (GRCm38)
  • C to T, chromosome 19 at 59,274,359 bp (GRCm38)
  • A to T, chromosome 19 at 59,300,787 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9368 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069177-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.